User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/06/18: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 16: Line 16:
Previous attempts at cloning a UTR1-deGFP linker into pBEST-pA-BamHI//XhoI-T500 backbone have failed. Sequencing showed a systematic error, whereby a truncated ~100bp piece was ligated, instead of the full UTR1-deGFP linker. Re-digesting and purifying the backbone showed the same result. Therefore, I am focusing on the linker. My hypothesis is that the PCR was mis-primed, so I designed a different set of primers to make the BamHI-UTR1-deGFP-XhoI linker. They were received today.
Previous attempts at cloning a UTR1-deGFP linker into pBEST-pA-BamHI//XhoI-T500 backbone have failed. Sequencing showed a systematic error, whereby a truncated ~100bp piece was ligated, instead of the full UTR1-deGFP linker. Re-digesting and purifying the backbone showed the same result. Therefore, I am focusing on the linker. My hypothesis is that the PCR was mis-primed, so I designed a different set of primers to make the BamHI-UTR1-deGFP-XhoI linker. They were received today.


* BamHI-UTR1-deGFP-XhoI-T500 sense primer: AATAATTTTGTTTAACTTTAAGAAGGAGATA 31b T<sub>H</sub> = 57.6 °C
* BamHI-UTR1-deGFP-XhoI-T500 sense primer: AATAATTTTGTTTAACTTTAAGAAGGAGATA, 31b, T<sub>H</sub> = 57.6 °C


* BamHI-UTR1-deGFP-XhoI-T500 antisense primer: ATGATAAAGAAGACAGTCATAAGTGC 26b T<sub>H</sub> = 57.3 °C
* BamHI-UTR1-deGFP-XhoI-T500 antisense primer: ATGATAAAGAAGACAGTCATAAGTGC, 26b, T<sub>H</sub> = 57.3 °C


* Template: pBEST-OR2OR1Pr-UTR1-deGFP-T500
* Template: pBEST-OR2OR1Pr-UTR1-deGFP-T500

Revision as of 14:50, 18 June 2012

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Jun6, 2012: Initial entry for PHIX174 research project

Research Log

The current log for this research project is linked to here: PHIX174_Research_Log_Jun-18-2012.txt. It will be updated at the beginning of each week. I am currently working on Characterization B and Hypothesis 2.

Characterization B

Previous attempts at cloning a UTR1-deGFP linker into pBEST-pA-BamHI//XhoI-T500 backbone have failed. Sequencing showed a systematic error, whereby a truncated ~100bp piece was ligated, instead of the full UTR1-deGFP linker. Re-digesting and purifying the backbone showed the same result. Therefore, I am focusing on the linker. My hypothesis is that the PCR was mis-primed, so I designed a different set of primers to make the BamHI-UTR1-deGFP-XhoI linker. They were received today.

  • BamHI-UTR1-deGFP-XhoI-T500 sense primer: AATAATTTTGTTTAACTTTAAGAAGGAGATA, 31b, TH = 57.6 °C
  • BamHI-UTR1-deGFP-XhoI-T500 antisense primer: ATGATAAAGAAGACAGTCATAAGTGC, 26b, TH = 57.3 °C
  • Template: pBEST-OR2OR1Pr-UTR1-deGFP-T500
  • PCR product size: 861 bp (after double digestion with BamHI and XhoI, size of BamHI-UTR1-deGFP-XhoI sticky linker will be 847 bp).
  • Using these primers and template, I performed standard PCR with TH = 58 °C, 24 cycles, and an elongation time of 1 min.

Hypothesis 3

Over the weekend, I attempted whole plasmid PCR to amplify PHIX174 by whole plasmid PCR (non-mutagenic primers) by the method described in Chen and Ruffner. No amplification observed. One line at 45b observed, corresponding to self-hybridization of the primers.


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Sean_P_Corum/Notebook/PHIX174_Cell_Free/2012/06/18&oldid=608339"