User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/06/18: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 7: Line 7:
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Jun6, 2012: Initial entry for PHIX174 research project==
==Jun6, 2012: Initial entry for PHIX174 research project==
* The current log for this research project is linked to here: [http://openwetware.org/images/6/62/PHIX174_Research_Log_Jun-18-2012.txt PHIX174_Research_Log_Jun-18-2012.txt]. It will be updated at the beginning of each week.  
* The current log for this research project is linked to here: [http://openwetware.org/images/6/62/PHIX174_Research_Log_Jun-18-2012.txt PHIX174_Research_Log_Jun-18-2012.txt]. It will be updated at the beginning of each week. I am currently  working on Characterization B and Hypothesis 2.


* Referring to the research log file, the first order of the day is Hypothesis 3. Over the weekend, I attempted whole plasmid PCR to amplify PHIX174 by whole plasmid PCR (non-mutagenic primers) by the method described in [http://nar.oxfordjournals.org/content/26/4/1126.short Chen and Ruffner]. No amplification observed. One line at 45b observed, corresponding to self-hybridization of the primers.
* Characterization B: Previous attempts at cloning a UTR1-deGFP linker into pBEST-pA-BamHI//XhoI-T500 backbone have failed. Sequencing showed a systematic error, whereby a truncated ~100bp piece was ligated, instead of the full UTR1-deGFP linker. Re-digesting and purifying the backbone showed the same result. Therefore, I am focusing on the linker. My hypothesis is that the PCR was mis-primed, so I designed a different set of primers to make the BamHI-UTR1-deGFP-XhoI linker. They were received today.
 
 
 
** BamHI-UTR1-deGFP-XhoI-T500 sense primer: AATAATTTTGTTTAACTTTAAGAAGGAGATA 31b Th = 57.6 °C
 
* BamHI-UTR1-deGFP-XhoI-T500 antisense primer: ATGATAAAGAAGACAGTCATAAGTGC 26b Th = 57.3 °C
 
* Template: pBEST-OR2OR1Pr-UTR1-deGFP-T500
 
*
 
* Using these primers and template, performed standard PCR with TH
 
* Hypothesis 3: Over the weekend, I attempted whole plasmid PCR to amplify PHIX174 by whole plasmid PCR (non-mutagenic primers) by the method described in [http://nar.oxfordjournals.org/content/26/4/1126.short Chen and Ruffner]. No amplification observed. One line at 45b observed, corresponding to self-hybridization of the primers.


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 14:07, 18 June 2012

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Jun6, 2012: Initial entry for PHIX174 research project

  • The current log for this research project is linked to here: PHIX174_Research_Log_Jun-18-2012.txt. It will be updated at the beginning of each week. I am currently working on Characterization B and Hypothesis 2.
  • Characterization B: Previous attempts at cloning a UTR1-deGFP linker into pBEST-pA-BamHI//XhoI-T500 backbone have failed. Sequencing showed a systematic error, whereby a truncated ~100bp piece was ligated, instead of the full UTR1-deGFP linker. Re-digesting and purifying the backbone showed the same result. Therefore, I am focusing on the linker. My hypothesis is that the PCR was mis-primed, so I designed a different set of primers to make the BamHI-UTR1-deGFP-XhoI linker. They were received today.


    • BamHI-UTR1-deGFP-XhoI-T500 sense primer: AATAATTTTGTTTAACTTTAAGAAGGAGATA 31b Th = 57.6 °C
  • BamHI-UTR1-deGFP-XhoI-T500 antisense primer: ATGATAAAGAAGACAGTCATAAGTGC 26b Th = 57.3 °C
  • Template: pBEST-OR2OR1Pr-UTR1-deGFP-T500
  • Using these primers and template, performed standard PCR with TH
  • Hypothesis 3: Over the weekend, I attempted whole plasmid PCR to amplify PHIX174 by whole plasmid PCR (non-mutagenic primers) by the method described in Chen and Ruffner. No amplification observed. One line at 45b observed, corresponding to self-hybridization of the primers.


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Sean_P_Corum/Notebook/PHIX174_Cell_Free/2012/06/18&oldid=608306"