User:Saroj Pandey/Notebook/SNP PCR optimization/2014/10/02: Difference between revisions
Saroj Pandey (talk | contribs) |
(fix raw html notebook nav) |
||
(8 intermediate revisions by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Line 9: | Line 9: | ||
• Genomic DNAs were used as templates to amplify different regions of DNA including the taste SNP | • Genomic DNAs were used as templates to amplify different regions of DNA including the taste SNP | ||
[[Image:combiPCR_02.10.jpg|right|thumb|400px|PCR program]] | |||
[[Image:combiPCRelec_02.10.jpg|right|thumb|400px|Electrophoresis]] | |||
'''Primer combinations''' | |||
1. Product size: 510bp [gaF + Gfb(R)] | 1. Product size: 510bp [gaF + Gfb(R)] | ||
Line 59: | Line 64: | ||
[[ | |||
'''Observation''' | |||
• [gaF+Gfb(R) and gaF+Cfb(R)] : Allele specific reverse primers showed bands with the corresponding templates just above 500bp. | |||
• [Gff(F)+gaR and Cff(F)+gaR] : Allele specific forward primer produced an expected specific band only with non-taster template but not with the taster one. Rather a thick bright band was seen at 100bp with taster template. | |||
• [Cfb(F)+Gfb(R) and Cfb(F)+Cfb(R)] : Allele specific reverse primers also worked with a different forward primer producing shorter bands (235bp) | |||
• [Gff(F)+Cff(R) and Cff(F)+Cff(R)] : Allele specific forward primers produced similar bands with both templates and were unable to distinguish between the two. | |||
'''Conclusion''' | |||
• Allele specific reverse primers when combined with a non-specific common forward primer are able to differentiate the SNPs. | |||
• There might have been pipetting error for different results seen with allele specific forward primers or they might not be the right primers to differentiate the taste SNPs. | |||
Latest revision as of 00:22, 27 September 2017
Project name | Main project page Previous entry Next entry |
PCR with different primer combinations• Genomic DNAs were used as templates to amplify different regions of DNA including the taste SNP Primer combinations 1. Product size: 510bp [gaF + Gfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC 2. Product size: 510bp [gaF + Cfb(R)] gaF: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGG 3. Product size: 522bp [Gff(F) + gaR] Gff(F): GGGATGTAGTGAAGAGGCAGG gaR: GCATCCCAGAAGAAACCAGA 4. Product size: 522bp [Cff(F) + gaR] Gff(F): GGGATGTAGTGAAGAGGCAGC gaR: GCATCCCAGAAGAAACCAGA 5. Product size: 235bp [Cfb(F) + Gfb(R)] Cfb(F): GGTGGCAACCAGGTCTTTAG Gfb(R): CAATCACTGTTGCTCAGTGC 6. Product size: 235bp [Cfb(F) + Cfb(R)] Cfb(F): GGTGGCAACCAGGTCTTTAG Cfb(R): CAATCACTGTTGCTCAGTGG 7. Product size: 161bp [Gff(F) + Cff(R)] Gff(F): GGGATGTAGTGAAGAGGCAGG Cff(R): GATGGCTTGGTAGCTGTGGT 8. Product size: 161bp [Cff(F) + Cff(R)] Cff(F): GGGATGTAGTGAAGAGGCAGC Cff(R): GATGGCTTGGTAGCTGTGGT
Observation • [gaF+Gfb(R) and gaF+Cfb(R)] : Allele specific reverse primers showed bands with the corresponding templates just above 500bp. • [Gff(F)+gaR and Cff(F)+gaR] : Allele specific forward primer produced an expected specific band only with non-taster template but not with the taster one. Rather a thick bright band was seen at 100bp with taster template. • [Cfb(F)+Gfb(R) and Cfb(F)+Cfb(R)] : Allele specific reverse primers also worked with a different forward primer producing shorter bands (235bp) • [Gff(F)+Cff(R) and Cff(F)+Cff(R)] : Allele specific forward primers produced similar bands with both templates and were unable to distinguish between the two.
• Allele specific reverse primers when combined with a non-specific common forward primer are able to differentiate the SNPs. • There might have been pipetting error for different results seen with allele specific forward primers or they might not be the right primers to differentiate the taste SNPs.
|