User:Saroj Pandey/Notebook/SNP PCR optimization/2014/09/19: Difference between revisions
Saroj Pandey (talk | contribs) |
Saroj Pandey (talk | contribs) |
||
| (One intermediate revision by the same user not shown) | |||
| Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
== | ==SNP PCR== | ||
'''Primers ending in G''' | |||
*fixed forward 161bp L: high 3' stability | |||
TAS2R38_1f: GGGATGTAGTGAAGAGGCAGG | |||
Length: 21 bp Tm: 61.0 °C GC: 57.1 % ANY: 2.0 SELF: 0.0 | |||
TAS2R38_1r: GATGGCTTGGTAGCTGTGGT | |||
Length: 20 bp Tm: 60.1 °C GC: 55.0 % ANY: 4.0 SELF: 0.0 | |||
Product Size: 161 bp Pair Any: 3.0 Pair End: 0.0 | |||
*fixed backward 235bp R: high end self complementarity | |||
TAS2R38_2f: GGTGGCAACCAGGTCTTTAG | |||
Length: 20 bp Tm: 59.6 °C GC: 55.0 % ANY: 6.0 SELF: 2.0 | |||
TAS2R38_2r: CAATCACTGTTGCTCAGTGC | |||
Length: 20 bp Tm: 58.0 °C GC: 50.0 % ANY: 6.0 SELF: 4.0 | |||
Product Size: 235 bp Pair Any: 5.0 Pair End: 1.0 | |||
'''Primers ending in C''' | |||
*fixed forward 161bp | |||
TAS2R38_C1f: GGGATGTAGTGAAGAGGCAGC | |||
Length:21 bp Tm: 61.2 °C GC:57.1 % ANY:3.0 SELF:3.0 | |||
TAS2R38_C1r: GATGGCTTGGTAGCTGTGGT | |||
Length:20 bp Tm: 60.1 °C GC:55.0 % ANY:4.0 SELF:0.0 | |||
*fixed backward 235bp | |||
TAS2R38_C2f: GGTGGCAACCAGGTCTTTAG | |||
Length:20 bp Tm: 59.6 °C GC:55.0 % ANY:6.0 SELF:2.0 | |||
TAS2R38_C2f: CAATCACTGTTGCTCAGTGG | |||
Length:20 bp Tm: 57.8 °C GC:50.0 % ANY:6.0 SELF:4.0 | |||
'''PCR 1''' | |||
• 2 sets of PCR was carried out for both taster and non-taster with genomic DNAs and PCR products as templates | |||
• 4 sets of primers were used to differentiate between the taster and the non-taster DNA | |||
[[Image:SNP_PCR1.JPG]] | |||
[[Image:Electrophoresis_GA_11.09.jpg|right|thumb|350px|Electrophoresis]] | |||
'''Agarose gel electrophoresis''' | |||
Gel preparation | |||
1. 1% agarose gel was prepared, for which 1g agarose was mixed in 100 ml water | |||
2. The mixture was heated at 600 °C for 90 seconds to completely dissolve the agarose | |||
3. 10µl gel red was added to the solution and mixed thoroughly | |||
4. Casting apparatus and comb was prepared | |||
5. The agarose solution was poured into the casting apparatus when lukewarm | |||
Sample Preparation | |||
loading dye [30% (v/v) glycerol + 0.25% (w/v) brophenol blue] | |||
• Ladder: 5µl water + 2µl loading dye + 2µl DNA ladder | |||
• Sample: 5µl water + 2µl loading dye + 5µl PCR product | |||
Sample loading and electrophoresis | |||
1. Approximately 450 ml of TAE buffer was poured into the electrophoretic chamber | |||
2. After the gel was set, it was transferred to the electrophoretic chamber and the comb was removed slowly without disrupting the sample wells | |||
3. Samples and DNA ladders were loaded into corresponding wells | |||
4. The electrophoretic chamber was closed and was connected to power supply | |||
5. Electrophoresis was run at 110V for 35 minutes | |||
6. The gel was observed under UV light | |||
Observation: | |||
• Position of none of the bands could be identified as all the bands appeared as smears | |||
• PCR with genomic DNA as templates gave fainter bands while the PCR with previous PCR product as templates gave brighter results | |||
Conclusions: | |||
• Nothing could be concluded abound the results obtained from PCR | |||
• The gel or the voltage and time for electrophoresis were not optimal to successfully separate the DNA bands | |||
'''Agarose gel electrophoresis (repeat)''' | |||
• To better observe the DNA bands in the PCR products, agarose gel electrophoresis was repeated | |||
• This time, the gel was prepared in TAE buffer instead of water | |||
• All other steps were the same as above | |||
[[Image:Electrophoresis_GA_12.09.jpg|right|thumb|350px|Electrophoresis]] | |||
Observations: | |||
1. PCR with genomic DNAs as templates | |||
• For taster, out of 4 PCR reactions, only the one with G (fixed forward) primers was able to produce expected result (161 bp). However, there was also other product below 100 bp. Such side products were also seen in other two reactions with G (fixed backward) and C (fixed forward) primers. A very faint smear was observed below 100 bp with C (fixed backward) primer. | |||
• For non-taster, G(ff) and G(fb) produced expected segments (161bp and 235bp respectively). There were side products below 100bp in all samples with more distinct in G(fb) and C(ff). | |||
2. PCR with previous PCR products as templates | |||
• For taster, products with G primers were opposite and those with C primers were as expected. However, there were several longer unexpected bands. | |||
• For non-taster, all the products produced expected band sized with a very faint with G(ff) primer. Several long unexpected bands were also observed. | |||
Conclusion: | |||
• There could have been pipetting errors during PCR and electrophoresis | |||
• It seems that the primers used here are not able to differentiate a change in one nucleotide | |||
• Appearance of longer side products may be due to the fragmentation of the templates | |||
'''PCR 2''' | |||
• Since the products of the previous PCR did not correspond to the expected results, the reaction was repeated and electrophoresis was carried out to view the results. | |||
[[Image:SNP_PCR2.JPG]] | |||
[[Image:Electrophoresis_GA_16.09.jpg|right|thumb|350px|Electrophoresis]] | |||
Observations: | |||
1. PCR with genomic DNAs as templates | |||
• While using genomic DNA template, both sets of C primers gave positive results for taster and G primers gave positive results for non-taster. | |||
• There was an expected band (161 bp) for taster with G (ff) primers but no band with G (fb) primers. | |||
• C (ff) and C (fb) produced negative results for non-taster | |||
• Two longer unspecific products were seen in taster with G(ff) primers | |||
• Unspecific bands less than 100 bp were seen in some of the samples | |||
2. PCR with previous PCR products as templates | |||
• Expected products of band size 161 bp and 235 bp were seen with both G and C primers for taster as well as for the non-taster. | |||
• There were several unspecific and longer products in all the samples | |||
Conclusion: | |||
• The primers used could not differentiate between one nucleotide and give products for both the taster and the non-taster | |||
• Unspecific products could have been the fragments of the templates used | |||
Revision as of 01:51, 22 September 2014
 Project name
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
SNP PCRPrimers ending in G
TAS2R38_1f: GGGATGTAGTGAAGAGGCAGG Length: 21 bp Tm: 61.0 °C GC: 57.1 % ANY: 2.0 SELF: 0.0 TAS2R38_1r: GATGGCTTGGTAGCTGTGGT Length: 20 bp Tm: 60.1 °C GC: 55.0 % ANY: 4.0 SELF: 0.0 Product Size: 161 bp Pair Any: 3.0 Pair End: 0.0
TAS2R38_2f: GGTGGCAACCAGGTCTTTAG Length: 20 bp Tm: 59.6 °C GC: 55.0 % ANY: 6.0 SELF: 2.0 TAS2R38_2r: CAATCACTGTTGCTCAGTGC Length: 20 bp Tm: 58.0 °C GC: 50.0 % ANY: 6.0 SELF: 4.0 Product Size: 235 bp Pair Any: 5.0 Pair End: 1.0
Primers ending in C
TAS2R38_C1f: GGGATGTAGTGAAGAGGCAGC Length:21 bp Tm: 61.2 °C GC:57.1 % ANY:3.0 SELF:3.0 TAS2R38_C1r: GATGGCTTGGTAGCTGTGGT Length:20 bp Tm: 60.1 °C GC:55.0 % ANY:4.0 SELF:0.0
TAS2R38_C2f: GGTGGCAACCAGGTCTTTAG Length:20 bp Tm: 59.6 °C GC:55.0 % ANY:6.0 SELF:2.0 TAS2R38_C2f: CAATCACTGTTGCTCAGTGG Length:20 bp Tm: 57.8 °C GC:50.0 % ANY:6.0 SELF:4.0
PCR 1 • 2 sets of PCR was carried out for both taster and non-taster with genomic DNAs and PCR products as templates • 4 sets of primers were used to differentiate between the taster and the non-taster DNA
Agarose gel electrophoresis Gel preparation 1. 1% agarose gel was prepared, for which 1g agarose was mixed in 100 ml water 2. The mixture was heated at 600 °C for 90 seconds to completely dissolve the agarose 3. 10µl gel red was added to the solution and mixed thoroughly 4. Casting apparatus and comb was prepared 5. The agarose solution was poured into the casting apparatus when lukewarm
loading dye [30% (v/v) glycerol + 0.25% (w/v) brophenol blue] • Ladder: 5µl water + 2µl loading dye + 2µl DNA ladder • Sample: 5µl water + 2µl loading dye + 5µl PCR product
1. Approximately 450 ml of TAE buffer was poured into the electrophoretic chamber 2. After the gel was set, it was transferred to the electrophoretic chamber and the comb was removed slowly without disrupting the sample wells 3. Samples and DNA ladders were loaded into corresponding wells 4. The electrophoretic chamber was closed and was connected to power supply 5. Electrophoresis was run at 110V for 35 minutes 6. The gel was observed under UV light
• Position of none of the bands could be identified as all the bands appeared as smears • PCR with genomic DNA as templates gave fainter bands while the PCR with previous PCR product as templates gave brighter results
• Nothing could be concluded abound the results obtained from PCR • The gel or the voltage and time for electrophoresis were not optimal to successfully separate the DNA bands
• To better observe the DNA bands in the PCR products, agarose gel electrophoresis was repeated • This time, the gel was prepared in TAE buffer instead of water • All other steps were the same as above  Observations: 1. PCR with genomic DNAs as templates • For taster, out of 4 PCR reactions, only the one with G (fixed forward) primers was able to produce expected result (161 bp). However, there was also other product below 100 bp. Such side products were also seen in other two reactions with G (fixed backward) and C (fixed forward) primers. A very faint smear was observed below 100 bp with C (fixed backward) primer. • For non-taster, G(ff) and G(fb) produced expected segments (161bp and 235bp respectively). There were side products below 100bp in all samples with more distinct in G(fb) and C(ff).
• For taster, products with G primers were opposite and those with C primers were as expected. However, there were several longer unexpected bands. • For non-taster, all the products produced expected band sized with a very faint with G(ff) primer. Several long unexpected bands were also observed.
Conclusion: • There could have been pipetting errors during PCR and electrophoresis • It seems that the primers used here are not able to differentiate a change in one nucleotide • Appearance of longer side products may be due to the fragmentation of the templates
• Since the products of the previous PCR did not correspond to the expected results, the reaction was repeated and electrophoresis was carried out to view the results.
1. PCR with genomic DNAs as templates • While using genomic DNA template, both sets of C primers gave positive results for taster and G primers gave positive results for non-taster. • There was an expected band (161 bp) for taster with G (ff) primers but no band with G (fb) primers. • C (ff) and C (fb) produced negative results for non-taster • Two longer unspecific products were seen in taster with G(ff) primers • Unspecific bands less than 100 bp were seen in some of the samples
• Expected products of band size 161 bp and 235 bp were seen with both G and C primers for taster as well as for the non-taster. • There were several unspecific and longer products in all the samples
• The primers used could not differentiate between one nucleotide and give products for both the taster and the non-taster • Unspecific products could have been the fragments of the templates used
| |
