User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/Entry Base

From OpenWetWare

Jump to: navigation, search
(March 5th 2013)
Current revision (01:52, 13 March 2013) (view source)
(March 5th 2013)
 
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
-
== March 5th 2013==
 
-
Synthesis of vanillin part asbF-1
 
-
Construction File
 
-
Mix oligos for one synthon, do PCA1 protocol              (517bp, pca1)
 
-
 
-
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol        (517bp, pca2)
 
-
 
-
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp                (472+26+19 bp, pcr_dig)
 
-
 
-
(get pre-digested vector from JCA of pBca9145-Bca1144 
 
-
 
-
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
 
-
 
-
asbF-1_oligo_3
 
-
>ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
 
-
 
-
asbF-1_oligo_1
 
-
> AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
 
-
 
-
Predict the product of each assembly step:
 
-
 
-
pca1
 
-
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 
-
 
-
pca2
 
-
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 
-
 
-
digestion with eco/bam
 
-
'''AATTC'''ATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCAT'''G'''
 
-
 
-
'''Thursdays Plan'''
 
-
Do Pca1 with vanillin asbF-1
 
-
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
 
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}
__NOTOC__
__NOTOC__

Current revision

Project name Main project page


Personal tools