User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/Entry Base

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Autocreated Lab Notebook name=User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/Entry Base, content from MediaWiki:EntryContentDefault)
(March 5th 2013)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
-
==Entry title==
+
== March 5th 2013==
-
* Insert content here...
+
March 5 2013 Synthesis of vanillin part asbF-1
-
 
+
Construction File Mix oligos for one synthon, do PCA1 protocol (517bp, pca1)
 +
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol (517bp, pca2)
 +
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp (472+26+19 bp, pcr_dig)
 +
(get pre-digested vector from JCA of pBca9145-Bca1144
 +
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
 +
asbF-1_oligo_3 >ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
 +
asbF-1_oligo_1 > AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
 +
Predict the product of each assembly step:
 +
pca1 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGA
 +
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}
__NOTOC__
__NOTOC__

Revision as of 01:36, 13 March 2013

Project name Main project page

March 5th 2013

March 5 2013 Synthesis of vanillin part asbF-1 Construction File Mix oligos for one synthon, do PCA1 protocol (517bp, pca1) PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol (517bp, pca2) Digest pca2 with EcoRI/BamHI (yes, BamHI), gp (472+26+19 bp, pcr_dig) (get pre-digested vector from JCA of pBca9145-Bca1144 Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence asbF-1_oligo_3 >ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT asbF-1_oligo_1 > AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA Predict the product of each assembly step: pca1 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGA

PCA protocol[1]


Personal tools