User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/2013/03/12

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Autocreate 2013/03/12 Entry for User:Megan_E._Garber/Notebook/BioE140L_-_synthesis_of_vanillin)
(March 5th 2013)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
-
== March 5th 2013==
+
== March 12th 2013==
-
Synthesis of vanillin part asbF-1
+
-
Construction File
+
Today in lab I did Pca1 zymo clean up and amplification steps with vanillin asbF1-1 and asbF1-3
-
Mix oligos for one synthon, do PCA1 protocol              (517bp, pca1)
+
-
+
-
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol        (517bp, pca2)
+
-
+
-
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp                (472+26+19 bp, pcr_dig)
+
-
+
-
(get pre-digested vector from JCA of pBca9145-Bca1144 
+
-
+
-
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
+
-
 
+
-
asbF-1_oligo_3
+
-
>ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
+
-
 
+
-
asbF-1_oligo_1
+
-
> AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
+
-
 
+
-
Predict the product of each assembly step:
+
-
 
+
-
pca1
+
-
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
+
-
 
+
-
pca2
+
-
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
+
-
 
+
-
digestion with eco/bam
+
-
'''AATTC'''ATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCAT'''G'''
+
-
 
+
-
'''Thursdays Plan'''
+
-
Do Pca1 with vanillin asbF-1
+
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->

Revision as of 00:42, 13 March 2013

Project name Main project page
Previous entry      Next entry

March 12th 2013

Today in lab I did Pca1 zymo clean up and amplification steps with vanillin asbF1-1 and asbF1-3 PCA protocol[1]


Personal tools