User:Megan E. Garber/Notebook/BioE140L - synthesis of vanillin/2013/03/05

From OpenWetWare

< User:Megan E. Garber | Notebook | BioE140L - synthesis of vanillin | 2013 | 03(Difference between revisions)
Jump to: navigation, search
(Autocreate 2013/03/05 Entry for User:Megan_E._Garber/Notebook/BioE140L_-_synthesis_of_vanillin)
Current revision (01:55, 13 March 2013) (view source)
 
Line 1: Line 1:
{|{{table}} width="800"
{|{{table}} width="800"
|-
|-
-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span>
+
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> March 5th 2013 </span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|-
|-
| colspan="2"|
| colspan="2"|
 +
== March 5th 2013==
 +
Synthesis of vanillin part asbF-1
 +
 +
Construction File
 +
Mix oligos for one synthon, do PCA1 protocol              (517bp, pca1)
 +
 +
PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol        (517bp, pca2)
 +
 +
Digest pca2 with EcoRI/BamHI (yes, BamHI), gp                (472+26+19 bp, pcr_dig)
 +
 +
(get pre-digested vector from JCA of pBca9145-Bca1144 
 +
 +
Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence
 +
 +
asbF-1_oligo_3
 +
>ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
 +
 +
asbF-1_oligo_1
 +
> AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA
 +
 +
Predict the product of each assembly step:
 +
 +
pca1
 +
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 +
 +
pca2
 +
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
 +
 +
digestion with eco/bam
 +
'''AATTC'''ATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCAT'''G'''
 +
 +
'''Thursdays Plan'''
 +
Do Pca1 with vanillin asbF-1
 +
'''PCA protocol'''[http://openwetware.org/wiki/Template:SBB-PCA]
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->

Current revision

March 5th 2013 Main project page
Next entry

March 5th 2013

Synthesis of vanillin part asbF-1

Construction File Mix oligos for one synthon, do PCA1 protocol (517bp, pca1)

PCR pca1 with asbF-1_oligo_3 and asbF-1_oligo_1 by PCA2 protocol (517bp, pca2)

Digest pca2 with EcoRI/BamHI (yes, BamHI), gp (472+26+19 bp, pcr_dig)

(get pre-digested vector from JCA of pBca9145-Bca1144

Ligate pcr_dig and vect_dig, transform, pick white colonies, map, sequence

asbF-1_oligo_3 >ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT

asbF-1_oligo_1 > AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATCTAATAAGACGTACA

Predict the product of each assembly step:

pca1 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

pca2 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

digestion with eco/bam AATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGAAGTATTCATTGTGTACCATCTCATTTAGGCACCAATTAATCTCATTCACAGATATAGTTCAATTCGCATACGAAAACGGATTTGAGGGTATTGAATTATGGGGAACACATGCTCAGAACTTGTATATGCAAGAGTATGAAACTACAGAAAGGGAATTGAATTGTTTAAAGGATAAGACCTTGGAAATTACTATGATTTCTGATTATTTAGACATTTCATTGTCAGCCGATTTCGAGAAAACAATTGAGAAATGTGAACAATTGGCAATTTTGGCTAATTGGTTTAAAACCAATAAAATAAGAACTTTTGCAGGACAAAAGGGTTCAGCTGACTTCTCACAGCAAGAAAGACAAGAATACGTAAATAGAATCAGGATGATTTGTGAATTGTTTGCACAGCATAACATGTACGTCTTATTAGATGAGACGGCATG

Thursdays Plan Do Pca1 with vanillin asbF-1 PCA protocol[1]


Personal tools