User:Kira G. Flaherty/Notebook/Biology 210 at AU

Lab 6: 16S Sequence Results; Idenitification of the Bacteria in the Transect
Kira Flaherty
Introduction Back in Labs 3 and 4, we prepared PCR samples using two of our bacterial samples from the agar plates and then ran them through gel electrophoresis. They were then sent off for sequencing, which is what is the focus of this entry. The purpose of this lab was to take the results sent back to us from the sequencing and using it to identify the bacterial samples grown on the petri dishes and living in the transect.
Materials and Methods
This lab involved taking the raw sequences from the 16S PCR products from the samples chosen from the gel electrophoresis process and putting them into BLAST to find a bacteria organism with a similar sequence. The two sequences were retrieved and each were plugged into BLAST and the matches for our sequences were indicated with a red line. The one with the closest match was used for each bacteria organism. The sequences were kept and the identifications of the bacteria were recorded.
Observations and Results
http://i57.tinypic.com/2rc22s2.png
Figure 1: Gel Electrophoresis
Figure 1 is an image of the gel electrophoresis and the two bacterial samples that were sent for sequencing are indicated with the red circle. These samples were originally from colonies 2 and 3 from the petri dishes (Figure 4 of Lab 3 Entry).
Raw Sequence 1: GGNNNNNNNNNNNNNNNNANNNTGCAGTCGTACAGGTAGCCGTAANTTGCTCTCGGGTGACGAGTGGCGGACGGGTGANT AATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAG AGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCG ACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGT GGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTT TCAGCGGGGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTACCCGCANAANAAGCACCGGCTAACTCCGTGC CAGCANCCGCGGTAATACGGANGGTGCAAGCGTTAATCGGNAATTACTGGGCGTAAAAGCGCACGCAGGCGGTCTGTCAA GTCGGATGTGAAANTCCCCCGGGCTCAACCTGGGAACTG
Bacteria Identification: Enterobacteriaceae
Raw Sequence 2: NNNNNNNNNNNNNNNNCNNNNNNNNGACAGCCGAGCGGTAGAGATCTTTCGGGATCTTGAGAGCGNGCGNTACGGGTGCG GANCNNNTGTGCAACCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATTGAATGGCA TCATTTGATATTGAAAACTCCGGTGGATAGAGATGGGCACGCGCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAG TCAGTGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGC AGTGAGGAATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACT TCTTTTGTATAGGGATAAACCTTTCCACGTGTGGAAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCA GCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCA GTGGTGAAATCTCATAGCTTAACTATGAAACTGCCATTGATACTGCAGGTCTTGAGTAAANGTANAAGTGGCTGGAATAA GTANTGTANCGGTGAAATGCATAGATATTACTTANAACACCNATTGCGANNCAGGTCACTATGNTTTAACTGACGCTGAT GGACGAAAGCGTGGGGAGCGAACNGGATTANATACCCTGGGTAGTCCACGCCGTAAACNATGCTAACTCGTTTTTGGNCT TTAGGGTTCAGANACTAAACNAAAGTGATNAGTTAAGCCNCCTGGGGANTACGTTCGCAAGAATGAAACTCANAGGAATT GAACGGGGGCCCGCACACCGGGGGATTATGTGGTTTANTNNNATNANTCNCANGGAACCNTACCANGCTAAATGGGNATT GANGGGTNNNNANTAGACTTTCTTCNANNNTTTCAANGNNCTNCATGGGTGGNNGNGNGCTNNNGCNNNNAAGNNNNNNN N
Bacteria Identification: Chryseobacterium
Conclusion
The two bacteria samples that were chosen for the PCR sequences were identified as Chryseobacterium and Enterobacteriaceae. Chryseobacterium is a type of bacillus type of bacteria and it is gram negative (Bloch, Nadarajah, Jacobs 1997). Because it is bacillus,it is a rod shaped bacterium. From looking at Google images of the colony, the colony is orange and circular, which supports our observations for colony 2 in the microbiology lab (Lab 3). It being gram negative is also supported. The other bacteria, enterobacteria, does not support our observations from Lab 3. This sample that was taken from colony 3 was identified as a gram-positive bacterium, but it is actually gram negative. It is also rod shaped (Barlett, Mazens-Sullivan, Lerer 1991), but our observations showed that this was tree-like shaped. This is probably because we had to use the sequences from another group who had the same transect. This is because our PCR product sequences were not of good enough quality and way to short to generate matches. The one that the other group used did fall in line with our observations, but the Enterobacteriacea did not because it was probably taken from a different type of colony.

Observing and Studying the Effect of Salinity on the Development and Survival of Zebrafish

Kira Flaherty
Introduction
In this experiment, the effect of salinity on the embryonic development, hatching rates, maturation and survival rates of zebrafish is observed, recorded and studied. Data collection for this experiment lasts for 2 weeks. The zebrafish start as embryos and their development over the two weeks will be observed and noted. The process of the experiment involves a control that consists of zebrafish living in distilled water. There are two different salinity treatments for two different groups of zebrafish. One group of zebrafish will be observed in 2% salinity and the other group will be studied at 1% salinity. The methods and results are separated by the day they belong to within the two weeks. The purpose of this experiment is to observe any changes in development and survival of the zebrafish because of salinity. It is hypothesized that higher levels of salinity will negatively affect development and survival rates of the zebrafish. If the salinity that the embryos of zebrafish is higher, then the development and maturation of the zebrafish will be slower and the hatching and survival rates will be lower.
Methods and Materials
Day 1: Primary Set Up for Zebrafish Experiment
Day 1 consisted of setting up the salinity experiment. Each zebrafish embryo used in the experiment was individually picked from a much larger population of zebrafish embryos in water using a transfer pipette. They were selected if they were alive. Them being alive was confirmed by looking at the embryos using a dissecting scope. There were three different groups of zebrafish in the experiment. Each group consisted of 20 zebrafish embryos.One group was a control group, one group was put in 2% salinity and the other group was put in 1% salinity. All liquid was put into the petri dishes using a Pipette-Aid. The control group was put in 20 mL of pure distilled water in a petri dish. The petri dish was labeled as control. 20 mL of 2% salinity solution that was available was put in a separate petri dish, in which the next group of 20 zebrafish were placed in. This petri dish was labeled with 2%. The final petri dish was prepared by adding 10 mL of the 2% salinity solution and 10mL of distilled water in order to dilute the 2% salinity solution to 1% salinity. The final group of 20 zebrafish were placed in this petri dish and the petri dish was labeled as 1%. The petri dishes were then set aside and weren't observed again until the following day (Bentley, Walters-Conte, Zeller 2015).
Day 2: First Day of Actual Data Collection
Day 2 consisted of looking at the zebrafish embryos in the three petri dishes to see if development was normal, which would most likely be around the 24 to 36 hour stage. A diagram of the stages was used to help with determining where the embryos were at in development. Each petri dish was examined using a dissecting scope. Any dead material was removed from the petri dishes using a transfer pipette. The amount of zebrafish embryos that were still alive were noted as well as the amount that were dead (Bentley, Walters-Conte, Zeller 2015). These recordings were taken in a table labeled by day and separated by petri dish. The next observation took place on Day 5 of the experiment.
Day 5: Second Day of Data Collection
Day 5 again consisted of observing the embryos to see if they have hatched and developed normally into the swimming larval stage. Again, any dead material was removed from the petri dish using a transfer pipette. The zebrafish were fed 1 drop of paramecium using a glass dropper. 1 drop was put in each of the petri dishes. The surviving zebrafish were then observed using a dissecting scope. The amount that were alive was recorded and so was the amount of zebrafish that were dead. Whether they were hatched or not was also recorded. Several characteristics were recorded in the table including stage of development, swimming, shape and phenotype, heartbeat and other interesting descriptions about the zebrafish (Bentley, Walters-Conte, Zeller 2015). The same table that was used on Day 2 was used for Day 5. 10 mL of whatever solution the zebrafish fish were in according to the group they were in were added to each of the petri dishes using a Pipette-Aid because of evaporation.
Day 8: Third Day of Data Collection
Day 8 again consisted of observing zebrafish. The 2% were all dead by day 5, so they are no longer being observed. Any dead material or zebrafish were removed from the 1% and control petri dishes. The methods were very similar to Day 5. 10 mL was again added to each of the petri dishes using a Pipette-Aid. The zebrafish were not fed on this day since they were fed on Day 5. The surviving zebrafish were observed using a dissecting scope for their phenotypic characteristics, their swimming and movement, their heartbeat and any other distinguishing characteristics. These details were again recorded in a table. The amount that were alive and hatched were recorded and the amount that were dead were also recorded along with their stage. 1 from each of the control group and 1% salinity were taken for preservation to be able to closely observe them. They were preserved using a small tube with a lid for each and filled about 1/4 of tricaine solution.
Day 12: Fourth Day of Data Collection
Day 12 had the exact same methods as Day 8.
Observations and Results
http://i62.tinypic.com/akcv1x.png http://i58.tinypic.com/55mqgz.jpg
Figure 1: Reference for Indication of Stages
These are the diagrams of zebrafish in various stages and what is used to indicate the developmental stages of the zebrafish in the tables.
http://i62.tinypic.com/28b8dxv.png
Table 1: Data Collection for Zebrafish Experiment
This table and layout will be used for the entire experiment and added on to as the two weeks continue. The observations collection so far took place on Day 2 and 5 of the experiment, as shown in the table. The table focuses on the behavior and development of the living zebrafish. All observations will be taken in this table. The table is split up so observations for each different group of zebrafish are clear.
http://i59.tinypic.com/2zhdq49.png
Table 2: Day 12
Table 2 is the exact same format as Table 1, just without the 2% salinity because they were no longer being observed because they were all dead.
http://i61.tinypic.com/vr61s2.jpg
Figure 2: Control Group Hatched Zebrafish
Figure 2 shows a picture of the hatched zebrafish in the control group. Their observations and characteristics were recorded in Table 1.
http://i59.tinypic.com/2upbigw.jpg
Figure 3: 1% Salinity Hatched Zebrafish
Figure 3 shows what the 1% hatched zebrafish looked like. The observations and characterisitics were recorded in Table 1.
http://i61.tinypic.com/208xz4k.jpg
Figure 4: Zebrafish in 24 Hour Gastrulation Stage
Figure 4 shows zebrafish embryos that remained in the 24 hour gastrulation stage that were present in both the control and 1% salinity groups.
http://i59.tinypic.com/205b32o.png
Figure 5: Control Zebrafish on Day 8
Figure 5 shows how the zebrafish developed on Day 8. They are in the F to G stages (Figure 1).
http://i60.tinypic.com/xpnpz.png
Figure 6: 1% Salinity Zebrafish on Day 8
Figure 6 shows the development thus far in the zebrafish in 1% salinity. Their development is behind when compared to the control, remaining in stages D-E (Figure 1). Their tails are not as long and slightly curved.
http://i61.tinypic.com/2gyaqls.png
Figure 7: Control Zebrafish on Day 12
Figure 7 shows a picture of the only group of zebrafish that remained alive on Day 12, which was the control group. They were in the G-H stages of development.

References
Bentley, M., Walters-Conte, K. & Zeller N. K. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology: American University, Washington, D.C. 59-62.

2.24.15 Excellent notebook entry. Thorough details and well organized. Good Vertebrate description chart and food web. SK

Lab 5: Introduction
Observing and Discussing the Invertebrates and Vertebrates of the Transect
Due 2/19/15
Kira Flaherty
This particular experiment included four parts to the procedure. The first three focused on the invertebrates of the transect and the fourth part focused on the vertebrates. The purpose of the experiment was to realize how important theses invertebrates and vertebrates are to our transect as well as studying them and identifying their characteristics. The invertebrates were observed for many characteristics. Five invertebrate organisms were observed and identified from the transect by measuring their length, recording how many there were and giving an overall description of the organism. The vertebrates were studied by identifying vertebrate organisms that would most likely inhabit the transect and then going into further descriptions for each organism (Bentley, Walters-Conte, Zeller 2015). There was no hypothesis needed because the experiment focused on observing and describing.
Materials and Methods
Part 1:Types of Worms and how they Move
Three different types of worms were observed. One was Planaria which is a acoelomate. It was observed in a glass jar where many were inhabiting. Its movements were recorded. The next organism that was observed was the nematode, which was observed using a dissecting scope. Its movements were also recorded. The last worm that was observed was a cellmate called Annelida. It was observed by looking at the container with dirt in which they were inhabiting. Its movements were recorded (Bentley, Walters-Conte, Zeller 2015).
Part 2: Classes and Orders of Anthropods
This part of the procedure focused on getting familiar with anthropods. The five major classes were observed and compared. These classes included arachnida, diplopoda, chilopoda, insect and crustacea (Bentley, Walters-Conte, Zeller 2015).
Part 3: Observing the Invertebrates from the Transect
The Berlese Funnel that was prepared last week was retrieved. The Berlese funnel was broken down. 10 to 15 mL of the liquid and matter was poured from the top into a petri dish. The rest of the liquid was poured into a different petri dish. The contents of both of the dishes were observed using a dissecting microscope. Five different invertebrates were identified. Their characteristics were recorded in a table. The length was measured using the ocular micrometer for each. How many of the specific type of invertebrate was recorded in the table. Each invertebrate was then described in the table and their phylum and class were identified (Bentley, Walters-Conte, Zeller 2015).
Part 4: Recognizing the Vertebrates of the Transect
The possible vertebrates that may live in the transect were thought about and considered. Five were identified, including two bird species. The phylum, order, class, family, genus and species was identified for each one. The parts of the transect that would be useful and beneficial to each organism were identified. From all of the organisms that have been observed from when this transect was first being studied, a food web was created (Bentley, Walters-Conte, Zeller 2015).
Observations and Results
http://imageshack.com/a/img538/975/FLH4XK.png
Table 1: Three Types of Worms and their Movements
Table 1 gives descriptions of three different types of invertebrates and their movements. The Planaria was the simplest of the three and the Annelida was the most complex.
http://imageshack.com/a/img901/56/M3pkcF.jpg
Figure 1: Planaria
Figure 1 is a picture of the Planaria that was used for the observations recorded in Table 1.
http://imageshack.com/a/img907/2078/zkXAXx.jpg
Figure 2: Nematodes
Figure 2 is the dissecting scope view of the Nematodes. They are hard to see in the picuture, but this is how observations were taken for Table 1.
http://imageshack.com/a/img537/354/YZwjHK.jpg
Figure 3: Annelida
Figure 3 is an image of Annelida, known as earth worms. These were observed for the descriptions recorded in Table 1.
http://imageshack.com/a/img661/1997/6D2Dwy.png
Table 2: Observing and Characterizing the Invertebrates of the Transect
Table 2 gives characteristics and detailed descriptions of the five organisms that were found in the transect. The organisms found were all of the Anthropoda phylum. The classes varied including Entognatha, Malacostraca, and Arachnida. There were two different types of springtails found, as well as a soli mite, a proturan and a pill bug.
http://imageshack.com/a/img540/9471/2zGaxc.jpg
Table 3: Five Possible Vertebrates Inhabiting the Transect
Table 3 gives five vertebrates that very well may be inhabiting the transect. Here listed is their phylum, class, order, family, genus and species. Included is two bird species, two types of rodents and a mole.
http://imageshack.com/a/img903/3391/TDSSvv.jpg
Table 4: Abiotic and Biotic Features Beneficial to the Vertebrates
Table 4 gives some abiotic and biotic features specific to the transect that would benefit and enhance the survival of each vertebrate.
http://imageshack.com/a/img673/2005/Akwnm2.jpg
Figure 4: Transect Food Web
Figure 4 is an image of a food web with every type of organism that was discovered from the transect included. The food web shows the relationship between species inhabiting the transect and how energy is transferred from organisms to other organisms.
Conclusions and Discussion
The purpose of this experiment was to discover and learn more about the invertebrates and possible vertebrates inhabiting Transect 2. The Invertebrates were discovered from the leaf litter in the Berlese Funnel set up. Using a dissecting scope, the type of invertebrate was able to be identified. The types of invertebrates that were discovered were two different types of springtails, a pill bug, a proturan and a soil mite. The size range for the invertebrates was not very big. It ranged from less than 1 millimeter to 2 millimeters. The smallest invertebrate observed was the soil mite, which was not even visible with the naked eye. The largest invertebrate was the pill bug at 2 mm and visible with the naked eye. The organisms that seem to be the most common from the leaf litter sample were organisms of the Entognatha class, but springtail was probably most common of the Entognatha class.
In this experiment, the possible vertebrates of the transect were also considered. This data involved more inferences rather than direct observations. The five possible vertebrates that were the focus of study were song sparrow, northern cardinal, black squirrel, eastern mole and eastern woodrat. Based on the abiotic and biotic features of the transect, it is very possible that all of these organisms could simultaneously be living and reproducing in the transect. Each of these organisms are of different species and therefore different populations. These different populations come together to form one community within the transect, which is the ecosystem. Some of these vertebrates do have similar diets, which would cause some competition between species within the transect. This competition for not only food but resources could affect the carrying capacity for each type of species. Carrying capacity is how much of a species can survive with the available resources in their habitat or environment. Some resources may be easier to get while others would be harder. This also affects the carrying capacity for each type of species since there are many that may be needing the same resources for survival. The food web that was included in this experiment gives an idea of trophic levels within the ecosystem. The trophic levels are represented by all of the organisms that have been discovered thus far for Transect two. The trophic levels that are shown in the food web include primary producers as the plants and dead plants, primary decomposers as the bacteria and some of the invertebrates, and secondary consumers as the vertebrates. There are higher trophic levels, but organisms that would fall into those levels have not been discovered for this transect, although it is very possible that some may inhabit it. (Freeman text)
For future experiments, just the overall procedure can always be done more precisely for better results. Regarding the transect experiment as a whole, better sample taking and direction following could have made the experiment's results even better than they already were.
References
Bentley, M., Walters-Conte, K. & Zeller N. K. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology: American University, Washington, D.C. 44-49.
Freeman text (as directed by lab manual).

2.19.15 Excellent lab book entry. Included all relevant data and description. SK

Lab 4: Introduction
Observing and Identifying the Plant and Fungi of our Transect
Due 2/12/15
Kira Flaherty
This experiment was very involved, but there were two main parts of the experiment. The purpose of the experiment was to study the variety, functions and other characteristics of the plants and fungi that are living in our transect. First five different plant samples were studied and many identifying characteristics about them were observed, including vascularization, specialized structures and mechanisms for reproduction. All of these characteristics distinguish one plant from the other. Types of fungi were then observed. There was one type of fungi in particular that was looked at and the characteristics that make it a type of fungi were analyzed. Plant and soil matter from the transect was also used to prepare for the experiment next week that focuses on the invertebrates from the transect. This experiment also involved preparation for our future experiment involving the PCR samples from last week. The gel electrophoresis process was used to observe the DNA sequence fragments from the PCR samples (Bentley, Walters-Conte, Zeller 2015).
Materials and Methods
Part 1: Studying the Plants of the Transect
Five different plant samples were retrieved from the transect in a Ziplock bag. A leaf litter of about 500g was also retrieved in a separate Ziploc bag. Seeds were also brought back from the transect. Pictures of trees and bushes were taken for the plant samples that came from them. The five plant samples were then observed for many different characteristics. A microscope was sometimes used to observe the plant's cross section to help with identifying characteristics. These characteristics were recorded in a table. The vascularization of each plant sample was described in the table and the height of each plant was recorded. Specialized structures of each plant were identified and recorded in the table. The leaves from the plant samples were specifically observed for their shape, size and cluster arrangement. The seeds were specifically observed for whether they were monocot or dicot and if there was evidence of flowering or sporing (Bentley, Walters-Conte, Zeller 2015).
Part 2: Taking a Deeper Look at Fungi
From the fungi samples that were available, one was chosen for the focus of study. A dissecting microscope was used to decide if the sample was indeed fungi and which type of fungi it was. A picture of the fungi was included and described (Bentley, Walters-Conte, Zeller 2015).
Part 3: Collecting Invertebrates Using a Berlese Funnel
25 mL of an ethanol and water solution(50% of each) was put into a 50 mL conical tube. Screening material was placed in a funnel to stop anything from the leaf litter falling through. The leaf litter was placed in the funnel. A ring stand was used to have the funnel placed in the tube of ethanol and it was set up by parafilming where the funnel went into the tube to prevent evaporation of the ethanol and water solution. A 40 watt lamp was placed over the set up and everything was covered with aluminum foil. This was set up to stay that way for a week (Bentley, Walters-Conte, Zeller 2015).
Part 4: Gel Electrophoresis
The last part of the experiment just involved running the DNA sequence fragments from the PCR samples through gel electrophoresis. This was done to determine which two bacterial samples that were going to be used for sequencing and identifying what bacterial organism the sample is.
Obervations and Results
http://imageshack.com/a/img673/124/wivekF.jpg
Figure 1: Five Plant Samples from the Transect
Figure 1 shows a picture of each of the five plant samples from the transect. The five plants chosen for study was a leaf, bark, berries, moss and tall garden grass. (Bentley, Walters-Conte, Zeller 2015).
http://imageshack.com/a/img673/1953/1Tfdf5.jpg http://imageshack.com/a/img537/8281/fIhq8Q.jpg http://imageshack.com/a/img537/3135/XXd5XP.jpg http://imageshack.com/a/img903/2583/5obn7y.jpg
Figures 2, 3, 4 & 5: Origins of the Plant Samples
These images show where the plant samples were obtained from within the transect. Figure 2 is the berry bush where the berries came from. Figure 3 is a bush where the leaf came from.The leaf was teardrop shaped and had a length of about 5 centimeters. The bush branched off and each branch varied in how many leaves were on it. Some only had 2 while others had many more, it just depended on the length of the branch. Figure 4 is a picture of the moss and garden grass. Figure 5 is the tree where the bark came from.
http://imageshack.com/a/img905/3491/e7Zgj4.jpg
Table 1: Characteristics of the Plant Samples
This table shows the recorded and observed characteristics of the plant samples from above.
http://imageshack.com/a/img913/8747/bsQUDw.jpg
Figure 6: Leaf Litter
Figure 6 shows where the leaf litter was obtained from within the transect.
http://imageshack.com/a/img673/8182/YzoHFi.jpg
Figure 7: Fungi
Figure 7 is a picture of the fungi that was observed.
http://imageshack.com/a/img911/1967/0cIb94.jpg
Figure 8: Identifying Fungi
Figure 8 is a microscopic view of the fungi that was chosen for study.
http://imageshack.com/a/img909/7982/RGKEq8.jpg
Figure 9: Gel Electrophoresis
Figure 9 shows the results of the gel electrophoresis. The two samples that were chosen for further sequencing were the two farthest to the right, samples 2 and 3.
Conclusion and Discussion There was no need for a hypothesis for this experiment because the purpose of it was to observe and study the characteristics of plants and fungi. The major groups and genuses of each of the five plants was identified. The moss is a non-vascular plant and falls into the group of Byrophyta. The berry bush is flowering with seeds inside the berries, so therefore it is an Angiosperm. The tree where the bark came from would fall within the Gymnosperms, as most trees do. The bush where the leaf came from would also be a Gymnosperm. The garden grass is a Gymnosperm as well (Bentley, Walters-Conte, Zeller 2015). All of the Gymnosperms have naked seeds unlike the Angiosperms that have their seeds surrounded by a fruit or something (Amsel 2015).
Four of the plants had seeds. The grass was monocot, the leaf was dicot, the berries were dicot and the tree was also dicot (Bentley, Walters-Conte, Zeller 2015). There was evidence of flowering with the berry bush because of the berries. There were also some more plants that had evidence of flowering present in the garden, but they were not chosen as one of the plants for our focus of study.
Fungi's sporangia is a part of their reproductive cycle. It is formed when two hyphae from two different fungi individuals come together. There are spores that are inside the sporangia, which are later released. This is the process of how some fungi reproduce. The fungi that was the focus of study was a type of mushroom, which is a Basidiocarp. It is a fungus because from the microscopic view the basidia is visible, which are specialized structures that are found under the cap of a mushroom (Bentley, Walters-Conte, Zeller 2015). This characteristic confirms the fact that this specimen is a mushroom and therefore a fungi.
References
Bentley, M., Walters-Conte, K. & Zeller N. K. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology: American University, Washington, D.C. 34-43.
Amsel, Sheri. "Characteristics of Plants". 2015. Exploring nature.org. (11 February 2015) <http://www.exploringnature.org/db/detail.php?dbID=26&detID=596>

2.10.15 Excellent lab book entry. Well organized. Clear data and observations. Good detailed description of procedures including the PCR setup. SK

Lab 3: Introduction
Characterizing and Observing the Microbiology from the Hay Infusion Culture
Due 2/5/15
Kira Flaherty
There were four parts to this experiment.The purpose of the experiment was to observe the microbiology of the Hay Infusion Culture from the transect. The characteristics of these organisms were studied, including their antibiotic resistance. Before any part of the procedure was started, the Hay Infusion Culture was observed one last time. The smell was not as strong as it was the previous week, but still had a somewhat dirty smell. There was also a lot less water because some of it evaporated. The hypothesis for this is that after another week, some of the organisms and bacteria that caused that strong smell died off. If there was less water and the smell was not as strong, then there must be some organisms dying off that originally caused the stronger smell. The actual procedures of this experiment consist of looking at the petri dishes that were prepared last week and seeing what bacteria grew on what plates and if there was any antibiotic resistant bacteria present and observing the bacteria that grew on the plates and characterizing them through microscopy. The last part of the lab was to prepare for next week's lab, which consisted of preparing PCR products (Bentley, Walters-Conte, Zeller 2015).
Materials and Methods
Part 1: Observing the Growth on the Agar Plates from the Hay Infusion Culture
The six agar petri plates that were prepared last week with the Hay Infusion Culture were retrieved. These plates included three that had an antibiotic tetracycline on them and three that did not. They were incubated for a week to have bacteria from the culture grown on them. A table including the plate's dilution, agar type, amount of colonies and colonies per mL was used to record data. The colonies that grew on the plates were counted for each plate and recorded in the table. The colonies/mL was determined based on the dilution of the particular plate (Bentley, Walters-Conte, Zeller 2015).
Part 2: Observing the Antibiotic Resistant Bacteria
The agar plates that had the the tetracycline were the focus of study for this part of the procedure. The colonies of bacteria that grew on the antibiotic resistant plates were compared to the colonies of bacteria that grew on the non-anbiotic plates. Their differences were noted (Bentley, Walters-Conte, Zeller 2015).
Part 3: Looking at the Bacteria Grown on the Agar Plates Using a Microscope There were two parts within this part of the experiment. Both involved observing the bacteria under a microscope. Three colonies of the agar plates that had bacteria growth were chosen to be studied for this part of the experiment and they were labeled on the petri dish (Bentley, Walters-Conte, Zeller 2015).
The first procedure of this part was the wet mount procedure. A glass slide was retrieved. A drop of water was put in the middle of the slide. A loop was sterilized and used to get a small amount of bacteria from one of the labeled colonies, then that bacteria was mixed with the drop of water on the slide. A cover slip was placed on top of the bacteria and water mixture. This process was repeated for the two other colonies. The loop was sterilized before each slide was prepared. All three slides were observed under a microscope at 10x and 40x. The shape of the cell for the organisms observed were noted in a table, and also if they were motile was noted in a table (Bentley, Walters-Conte, Zeller 2015).
The second procedure was the gram stain procedure. Three slides were again used with a drop of water in the middle of each. A loop was sterilized again and used to get a small amount of bacteria from each of the labeled colonies, with the loop being sterilized between each slide. The bacteria was mixed with the water. The slide needed to be completely dry, so it was air dried by passing it through an open flame as many times necessary to have the slide completely dry with the bacterial smear up. This was done for each slide. Each slide then went through the gram staining process, which consisted of using a staining tray and first covering the bacteria smears with crystal violet for a minute then rinsing them with water. Then Gram's iodine mordant covered the smears for a minute and it was rinsed again with water. 95% alcohol was then poured over the slides for 10-20 seconds for decolorization and then gently rinsed with water. The smear was then covered with safranin for 20-30 seconds then rinsed with water. Excess water was removed. The gram stains of each of three colonies were then observed under a microscope. Their characteristics including colony description, colony description, gram+ or -, and additional notes were included in the table used in the wet mount procedure (Bentley, Walters-Conte, Zeller 2015).
Part 4: PCR Preparation
A colony of bacteria was put in 100 microliters of water in a sterilized tube. It was then incubated at 100 degrees Celsius for 10 minutes. This was done for each colony. The tubes were then centrifuged for 5 minutes at 13, 400 rpm. 20 micrometers of primer was added to the PCR tubes for each colony sample and the PCR bead was dissolved. Once the samples were done centrifuging, 5 microliters of supernatant was put in each PCR reaction for each colony sample and then placed in the PCR machine (Bentley, Walters-Conte, Zeller 2015).
Observations and Results
http://imageshack.com/a/img907/5219/RtkHoO.jpg http://imageshack.com/a/img905/7118/JKfquD.jpg
Figure 1: Last Observation of Hay Infusion Culture
Above is the last time the Hay Infusion Culture was observed. There is a lot less water and the smell wasn't nearly as strong nor sewage-like. It still smelled dirty, however. The color was a lot darker, and there didn't seem to be as much mold. These observations lead to the hypothesis presented in the introduction, in which it was hypothesized that the smell wasn't as strong because bacteria that caused the stronger smell were dying off.
http://imageshack.com/a/img537/569/QOQLSk.jpg http://imageshack.com/a/img540/8544/U4ULfK.jpg http://imageshack.com/a/img905/2694/FOwWnW.jpg
Figures 2, 3 and 4: Observed Bacteria Growth from Serial Dilutions
Figures 2 and 3 compares the bacteria growth on the two different type of plates, the ones with antibiotic tetracycline and the ones without. There were no bacterial colonies on any of the tetracycline plates, but there was some fungi present. Figure 4 shows a better view for the only two plates, that did not have tetracycline, that had any bacteria growth present. These plates had dilutions of 10^-7 and 10^-5. "tet" was labeled on the plates that have tetracycline. The colonies that were used throughout the experiment were labeled 1, 2 and 3.
http://imageshack.com/a/img537/745/TG9dHq.jpg
Table 1: Bacteria Growth on Agar Plates Results
Table 1 shows the results from the bacteria that grew on the agar petri dishes. There wasn't any growth on any of the antibiotic plates. There was growth on two of the non-antibiotic plates, which had 10^-7 and 10^-5 dilutions.
http://imageshack.com/a/img905/5457/R7H3FO.jpg
Table 2: Characteristics of the Bacterial Colonies and the Organisms within them
Above is a table that includes all of the descriptions and characteristics of the three bacteria types from three different colonies from the agar petri dishes. These labeled colonies can be found in Figure 4. The descriptions of the colonies were included in the table, as well as the organism's picture through microscope and the magnification used. Their motility and shape was described, and whether they were gram + or - was included. The dilutions for each colony were also included in this table. The three types of bacteria were identified as Bacillus, Fusobacterium and Coccobacillus. The motility was determined through the wet mount procedure, and most of the other characteristics were determined through the gram stain procedure.
http://imageshack.com/a/img631/8879/Dsqc0W.jpg http://imageshack.com/a/img540/2426/FwpfjN.jpg http://imageshack.com/a/img540/3360/pjSo9j.jpg
Figures 5, 6 and 7: Microscopic View for Bacteria from Colony 1, 2 and 3
These are the microscopic views of the gram stains of the bacteria. Figure 5 is from colony labeled 1, Figure 6 is from colony 2 and Figure 7 is from colony 3. It was difficult to get a good picture, which is why the table was used for detailed descriptions and pictures. All of these images are at 100x magnification. Figures 5 and 7 are reddish, which are gram negative organisms. Figure 6 is gram positive because it is a dark-purplish color.
Conclusion and Discussion
The purpose of this experiment was to observe the microbiology from the Hay Infusion Culture through serial dilutions. The dilutions were put on petri dishes, three that had no antiobiotic and three that had the antibiotic tetracycline. They were incubated for a week at room temperature. The results show that there wasn't any bacterial growth on the plates with the antibiotic, which indicates that there wasn't any bacteria present that was resistant to the antibiotic. The plates that didn't have antibiotic, however, did have bacterial growth. This can be seen in Figures 2 through 4. The tetracycline did not allow any bacterial growth, but there was some fungi. The fungi was the only organism that was present, so it was the only observed organism not affected by the tetracycline. There was no fungi on the plates without tetracycline. Tetracycline's method of action involves stopping protein synthesis within the bacterial organism. It is able to go through channels that are in the membrane of the bacterial cells and bind to the 30S ribosomal unit, which doesn't allow tRNA to bind to the mRNA-ribosome complex. This process doesn't allow protein synthesis to continue. The types of bacteria that are affected by this antibiotic are types of eubacteria, including enteric bacteria which can be found in the intestines (DrugBank: Tetracycline 2013).
From the bacteria that grew on the two petri dishes with 10^-7 and 10^-5 dilutions, there were three different types of bacteria colonies that were the focus of study. The bacteria from colonies 1 and 2 were very similar in their colony description, physical appearance and other characteristics included in Table 2. It was determined that they both were forms of Bacillus bacteria. The bacteria from colony 3 was very different from the other two. The colony itself had a different texture and color, as noted in Table 2. There also were very few other colonies that looked similar on the petri dishes with growth, which means that this type of bacteria was not as common as the other two, which many colonies looked similar to. From the gram staining procedure, it was determined that the bacteria from colonies 1 and 2 were gram negative, which means there is less peptidoglycan in their cell wall. The bacteria from colony 2 was determined to be gram positive, which means there is no outer membrane and there is more peptidoglycan present in the bacteria's cell wall.
Archaea are organisms that tend to live in extreme conditions (Bentley, Walters-Conte, Zeller 2015). I would not think that they would have grown on the agar plates. This is because the agar plates were incubated at room temperature, which is not extreme at all. There may be some types of archaea that can survive in conditions like in a petri dish at room temperature, but I would infer more often than not that archaea would not grow on these petri dishes in these conditions.
For next time, the images taken of the microscopic views could be better. It was very hard to get a clear picture, but then just better descriptions have to be made to make up for it. It was also hard to keep track of which bacteria samples came from which colonies, which is a problem that can be fixed by just being more organized and cautious with the procedures.
References
Bentley, M., Walters-Conte, K. & Zeller N. K. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology: American University, Washington, D.C. 25-32.
"DrugBank: Tetracycline". 16 September 2013. Canadian Institutes of Health Research, Alberta Innovates - Health Solutions & The Metabolomics Innovation Centre. (4 February 2015) <http://www.drugbank.ca/drugs/DB00759>

2.4.15 Excellent notebook entry. Included lots of relevant detail on Hay Infusion and protist identification. SK

Lab 2: Introduction
Observing the Hay Infusion Culture and Using a Dichotomous Key to Identify Organisms
Due 1/29/15
Kira Flaherty
This experiment included three parts. The first part was using a dichotomous key to identify one known organism. The second part of the experiment was to observe the Hay Infusion Culture that was made using the sample from the transect from last week. Different organisms of two different niches were identified from the Hay Infusion Culture. The third part of this experiment was to create serial dilutions in preparation for a future lab that focuses on the microbiology of the Hay Infusion Culture. The purpose of this experiment was to observe and identify the organisms that are living in the Hay Infusion Culture from a certain transect and to successfully identify organisms using a dichotomous key, as well as preparing for observing bacteria from the culture in next week's lab. (Bentley, Walters-Conte, Zeller 2015)
Methods and Materials
Part 1: Getting Familiar with Using a Dichotomous Key
For the first part of the experiment, a wet mount of known organisms was retrieved. This was done by using a glass slide, Protoslo and a cover slip to prepare a slide that was viewed under a microscope. When it was placed on the microscope, it was viewed at 4X objective and the 10X objective. One organism that was found was the focus of study and its characteristics, including the shape, color and colony size, were described. It was measured using the ocular micrometer within the lens of the microscope. A dichotomous key was used to identify the organism that was the focus of study. (Bentley, Walters-Conte, Zeller 2015)
Part 2: Identifying Organisms of Different Niches from the Hay Infusion Culture
The Hay Infusion Culture was observed. Two different niches within the culture were observed. One niche was from the bottom surface of the culture and the other niche was from the surface of the water. A wet mount of each was prepared on a slide with Protoslo and a cover slip that was viewed under a microscope. Three different organisms from each niche's wet mount were identified and described, making a total of six organisms. Each organism was measured using the ocular micrometer. Other characteristics of each organism were noted including the general look/shape, a picture of the organism and the organism's method of motility. (Bentley, Walters-Conte, Zeller 2015)
Part 3: Preparing to Study Bacteria from the Hay Infusion Culture through Serial Dilutions
Three tubes of 10 mL sterile broth were retrieved. One was labeled 10^-4, one was 10^-6 and the last was 10^-8. Six agar petri dishes were retrieved that included three that had tetracyline and three that did not. The plates that had tetracyline were labeled so that they didn't get mixed up with the other three plates. For the tetracycline plates, one was labeled as 10^-5, one was 10^-7 and one was 10^-9. The same labeling process was done for the plates without tetracycline. The Hay Infusion Culture was then gently mixed by swirling the jar with the lid on. A micropippetor was used to transfer 10 μL of the culture to the 10^-4 broth tube. The tube was swirled to mix the contents. Using the micropippetor again, 100 μL from the mixed 10^-4 tube was then added to the 10^-6 broth tube, which was also mixed by swirling. Then, 100 μL from the 10^-6 tube was added to the 10^-8 tube, which was mixed by swirling. 100 μL from the 10^-4 broth tube was then added to each of the 10^-5 petri dishes (one with tetracycline and one without). The same was done for the 10^-7 petri dishes, but using the 10^-6 broth. The same process was done for the 10^-9 petri dishes, but using the 10^-8 broth. For each petri dish, the broth was spread across the agar by using a sterilized glass spreader. The lids were placed on the petri dishes. The petri dishes with the tetracycline were wrapped in tin foil. All of the petri dishes were set aside to be incubated for a week in room temperature. (Bentley, Walters-Conte, Zeller 2015)
Observations and Results
http://imageshack.com/a/img540/1554/F6hVzC.jpg
Figure 1: Microscopic View for Looking at a Known Organism in Part 1 of Procedure
From the dichotomous key, the above organism was identified as Gonium. It is a disc-shaped organism, with a green coloring. The colony size for this organism was about 16 cells. It was measured as about 10 μM using the ocular micrometer.
http://imageshack.com/a/img538/3797/wGNR1M.jpg http://imageshack.com/a/img537/9817/lmB47P.jpg
Figures 2 & 3: Images of the Hay Infusion Culture from Transect 2
Above is two different views of the Hay Infusion Culture that was performed with the sample from transect 2.
Observations
The smell of the culture was not a good smell-- It was a smell that was comparable to sewage-like smell. There was some growth on the surface, looks like molds. The two niches that were observed were the bottom of the jar and the surface of the water.
http://imageshack.com/a/img538/1978/ARg8WC.jpg
Figure 4: Oberved and Identified Organisms from Two Different Niches of the Hay Infusion Culture
Above are pictures and descriptions for each of the six organisms from the Hay Infusion Culture. Three different organisms for each niche was identified using a dichotomous key, as shown in the image. They were measured with the ocular micrometer. Plant matter was included in the observed wet mounts so there would be more of a variety of organisms. Some organisms may live off or use plants in some way to enhance survival while some organisms don't rely on plant matter at all. All of the organisms were motile, and either protozoa or algae.
http://imageshack.com/a/img537/8693/8jvzyn.jpg
Figure 5: Serial Dilutions This is a diagram of the process of creating the serial dilutions. These petri dishes will allow the microbiology of the Hay Infusion Culture to be observed after a week for incubation.
Conclusion and Discussion
There was no need for a hypothesis and prediction for this experiment because it focused on successfully using a dichotomous key and to observe the organisms that were in the Hay Infusion Culture. In Part 1 of the procedure, the known organism was identified as Gonium. It was a green, disc-shaped organism and followed the description and diagram of the Gonium organism given by the dichotomous key. The dichotomous key also was beneficial in identifying the organisms of the two niches from the Hay Infusion Culture. The protozoa seemed to be more present on the surface niche, while the algae was more present on the bottom niche. If the Hay Infusion Culture grew for another two months, then I would predict more organisms of different forms and species to be present, as well as more growth of mold. The water would also continue to evaporate, which may affect the organisms that are able to survive and the carrying capacity. There would probably be an organism or several that could survive the best, so it or they may take over the culture and be the most present organism.

Paramecium Bursaria was one of the organisms found in the Hay Infusion Culture, from the surface of the water niche. It is a protozoa. The Freeman texts describes something alive by being able to use energy, having cells, processing information through genes and transferring/receiving information in the environment, replicating itself and continuing to go through evolution. Because this Paramecium Bursaria is alive, it does all of these things. It is unicellular, which means the entire organism is a cell, so it follows that requirement. It is able to obtain energy by eating other microorganisms and storing food in its central vacuole. It then gets energy from that stored food to move and other things to survive. Paramecium communicates with its environment by being able to sense different chemicals and using cilia to recognize its surroundings. Paramecium most often reproduce asexually, but can also reproduce through sexual reproduction (Parker 1982). There are different forms of Paramecium, some more advanced, which can show how evolution is continuing to happen.

For the next time observing organisms under a microscope, better diagrams and observations can be made. This would make identifying and making inferences about the organism easier. It would also make the data more valuable because different parts of the organisms could be identified and the information would be more credible.
References
Bentley, M., Walters-Conte, K. & Zeller N. K. 2015. A Laboratory Manual to Accompany: General Biology II. Department of Biology: American University, Washington, D.C. 18-24.
Parker, Sybil P. 1982. Paramecium. Synopsis and Classification of Living Organisms, 1. Retrieved from http://101science.com/paramecium.htm.

1.27.15 Excellent first entry. Well structured, clear image and thorough description of procedures. Keep up the good work. SK

Introduction
Bacteria and Protists of an AU Transect and the Volvocine Line
Due 1/26/15
Kira Flaherty
There were two parts of this experiment. The first was to study organisms within the Volvocine Line to observe evolution . These organisms were forms of green algae. The second part of the experiment was to observe and discuss the abiotic and biotic components that make up a transect acting as an ecosystem. Transect #2 was the focus of study. With the transect, we will be able to study the protists and bacteria that are within our transect through a Hay Infusion Culture process. Each transect has abiotic and biotic parts that make up the transect that is acting as an ecosystem. We can make conclusions and discuss our transect by observing the abiotic parts and the living organisms. The purpose of this experiment is to study and observe the organisms that are living in our assigned transect, and also observe evolution by looking at organisms of the Volvocine Line. (Bentley, Walters-Conte, Zeller 2015)
Methods and Materials
Part 1: Organisms of the Volvocine Line
In Part 1, 3 different green algae organisms of the Volvocine Line were observed. The organisms were the unicellular Chlamydomonas, multicellular Gonium and the most advanced Volvox. A table was created that included each organism in its own column. Each column was broken up into rows for various characteristics including number of cells, colony size, specialization of cells, motility, isogamous or oogamous and the picture of the organism. A microscope was used to study and identify these characteristics of these organisms. Slides for each organism were created by using a pipette, Protoslo, to slow the organism down, and a cover slip. The colony size of the cells were measured using the ocular micrometer within the lens of the microscope. (Bentley, Walters-Conte, Zeller 2015)
Part 2: Transect
The transect was found. An aerial view of the transect was sketched. All abiotic and biotic features of the transect were included and labeled. With a 50mL conical tube, a sample of the soil, vegetation and other things that made up the transect was retrieved. A Hay Infusion Culture was made to observe in future labs. To make the Culture, 10-12 grams of the sample of the transect was placed in a clear jar. 500 mL of bottled water was then added to the jar. 0.1 grams of dried milk was put into the jar and the contents of the jar were mixed. The jar was placed somewhere safe (somewhere it can stay for a week without being harmed) without the lid. After a week went by, the protists and bacteria from the Hay Infusion Culture were observed. (Bentley, Walters-Conte, Zeller 2015)
Observations and Data
http://imageshack.com/a/img913/2632/6HN6pO.jpg
Figure 1: Observed Transect
This is an image of the transect. The location of the transcript was on AU's campus, right near Hughes Hall. There were several abiotic and biotic components of the transect, as listed and labeled in the image. The top of the picture is north, the right is east, the left is west and the bottom is south.
http://imageshack.com/a/img537/1923/TgA174.jpg
Table 1: Observing Various Organisms of the Volvocine Line to Observe Evolution
This is a table that was used to compare Chlamydomonas, Gonium and Volvox. Volvox is the most advanced. Evolution can be observed by seeing the advancements in Volvox when compared to Chlamydomonas and Gonium.
Conclusion and Discussion
This particular experiment did not require a hypothesis or prediction because the purpose was just to observe evolution by looking at green algae of the Volvocine Line and to observe a transect, then set up a Hay Infusion Culture for future observations. Looking at the table of the Chlamydomonas, Gonium and Volvox, evolution can be observed. The most simplistic of the organisms is Chlamydomonas: unicellular, small colonies, no specialization of cells, isogamous and motile through the flagella. Then it is Gonium: multicellular, small colonies as well, no specialization of cells, motile (in a matrix) and isogamous. The Volvox is the most advanced and evolved of the three with about 1500 for number of cells, much bigger colonies than Gonium and Chlamydomonas, specialization of reproductive cells, nonmotile and oogamous.
The transect included many abiotic and biotic components. The biotic components included grass, trees, moss, bushes, insects, bacteria and other living organisms. The abiotic components included snow, dead leaves, fallen twigs, rocks, signs, a bench and soil. Many different species and classes of organisms were living within this same transect, which makes it a biodiverse ecosystem. The organisms within the ecosystem all have different niches and interact in ways that enhance survival (Bentley, Walters-Conte, Zeller 2015). A Hay Infusion Culture was made to be able to observe other organisms that can't be seen with the naked eye within the transect.
There is always room for improvement. For next time, something like a transect can be looked at even closer and the observations can be more precise. This will take more time and effort, but will be more beneficial to the outcome of the experiment.
References Bentley, M., Walters-Conte, K. & Zeller N. K. A Laboratory Manual to Accompany: General Biology II. Department of Biology: American University, Washington, D.C. 12-17.