User:Karmella Haynes/Notebook/BioBrick cloning/2015/05/05: Difference between revisions

Revision as of 19:38, 5 May 2015

Karmella's BioBrick Cloning

<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>      </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

05/05/15

KAH87/MV10 - minipreps (5x 5mL)
Ryan - clone-in Receiver promoters
Cas-tone Project - plan assembly strategy, order primers

Minipreps

Sigma GenElute kit
Elute w/ 75 μL elution sln.
Check with NotI/XbaI digests

Reagent	Volume	Expected: KAH87 fwd/MV10 = ~6150, 36, 28 KAH87 rev/MV10 = ~5100, 1089, 28 MV10 = ~5100, 36, 28	Hover name 15 μL/lane; 1% agarose; Ladder
DNA(plasmid)	2.0 μL
10X buffer	1.5
NotI	1.0
XbaI	1.0
dH₂O	9.5
	15 μL --> 37°C/ ~15 min.

Measure conc.'s

Sample	OD260	260/280	ng/μL
1. KAH87/MV10-1	0.273	1.948	273.0
2. KAH87/MV10-2	0.341	1.940	341.5
3. KAH87/MV10-3	0.319	1.937	318.5
4. KAH87/MV10-4	0.248	1.948	248.1

Conclusions:

Success! Clone #3 has forward insertion
Discard - clones 1, 2, 4 are reverse insertions

Ryan - PCR & Dig/Lig (promoter insert trial #3)

Ryan - Receiver plasmids, assembly - REVISED STRATEGY (PCR promoters)

Stage 1 - insert Regulator ORFS
- Phusion PCR-amplify ORFs (add 5'-E, 3'-X cut sites)
- Insert ORF(E/X) into Vector (E/X). see Vector plasmid map
Stage 2 - insert Promoters
- Phusion PCR-amplify promoter inserts (new primers)
- Cut promoters with E/S & dephos
- Insert promoters(E/S) into Vector/Regulator (BbsI) via Lig/Dig cycling

Assemblies

pAub/AubR/MRV: pAub(E/Xdp)/153 + AubR/MRV(BbsI)/4087
pBja/BjaR/MRV: pBja(E/Xdp)/122 + BjaR/MRV(BbsI)/3977
pBra/BraR/MRV: pBra(E/Xdp)/214 + BraR/MRV(BbsI)/3977
pRpa/RpaR/MRV: pRpa(E/Xdp)/136 + RpaR/MRV(BbsI)/3980

Vector concentrations (ng/μL)

AubR/MRV, 257.7
BjaR/MRV, 177.3
BraR/MRV, 465.4
RpaR/MRV, 246.2

Phusion PCR-amplify promoters

pAubR, EcoRI fwd, SpeI rev
pBjaR, EcoRI fwd, SpeI rev
pBraR, EcoRI fwd, SpeI rev
pRpaR, EcoRI fwd, SpeI rev

Reagent	Vol	Mix (x5)	Expected: 1. pAubR = 153 2. pBjaR = 122 3. pBraR = 214 4. pRpaR = 136	Hover name 5 μL/lane; 1% agarose; Ladder
gBlock DNA (2 ng/μL)	0.5	---
10 μM EcoRI fwd	1.0	5.0
10 μM SpeI rev	1.0	5.0
10 mM dNTPs	1.0	5.0
5x HF buffer	10.0	50.0
Phusion Pol.	0.5	2.5
dH₂O	36.0	180.0
	50.0 μL

Thermal cycler: Bio-Rad - Phusion

98°C 3 min.
30x[98°C, 10 sec; 66°C 30 sec; 72°C 30 sec]
72°C 3 min.
4°C, ∞

Clean up PCR
- Qiagen PCR purification kit
- Elute w/ 30 μL elution buffer

Measure conc.'s

Sample	OD260	260/280	ng/μL
1. pAubR PCR	0.021	1.707	20.8
2. pBjaR PCR	0.018	1.851	18.3
3. pBraR PCR	0.026	1.807	25.5
4. pRpaR PCR	0.018	1.720	17.8

Digests (Fermentas FD)
- Use clear FD buffer (no dye)

Reagent	Volume
DNA (250 ng PCR)	up to 16.0
10x clear FD buffer	2.0
EcoRI	1.0
SpeI	1.0
dH₂O	---
	20.0 μL

--> 37°C/ ~15 min.

Dephosphorylation (Roche)
- Add 1.0 SAP (Roche) to each rxn.
- 37°C/ 10 min.; 75°C/ 2 min.; [final] = 12.5 ng/μL

Dig/Lig reactions
- 2:1 ratio calculation: ~150 bp insert / ~4000 bp vector * 2 * 100 = 3.75 ng insert

pAub-PCR(E/S dp) + AubR/MRV
pBja-PCR(E/S dp) + BjaR/MRV
pBra-PCR(E/S dp) + BraR/MRV
pRpa-PCR(E/S dp) + RpaR/MRV

Reagent	Rxn	Mix (x5)
100 ng Vector	### (up to 13.5)	---
insert	1.0	---
10x FD buf	2.0	10.0
10 mM DTT	1.0	5.0
10 mM ATP	1.0	5.0
FastDigest BbsI/BpiI	1.0	5.0
Roche T4 DNA ligase	0.5	2.5
dH₂O	###	---
	20.0

--> Pipette 6.5 μL master mix into each PCR tube
--> Add 100 ng vector DNA
--> Add 13.5 - vector volume dH₂O --> Mix by flicking

LabNet OptiMax Thermocycler: BbsI Dig/Lig

6x [37°C, 5 min; 23°C, 5 min]
4°C, ∞

Transformation(s)

Thaw 2 tubes chem competent DH5α-turbo on ice
Transfer 10.0 μL each ligation to fresh sterile 0.5 mL tube
Add 50 μL DH5α-turbo; pipette up-and-down 3x GENTLY
Incubate 5 min. on ice
Plate on 100 μg/mL amp
- Split ligations in 1/2, do rapid protocol

RESULTS (5/06/15)

tba

Cas-tone Project

STAGE 1 - pcDNA-dCas9-VP64 vector re-design
- Knock-out VP64 from C-terminus - replace AscI-VP64:HA:STOP-EcoRI-XbaI with AscI-HA:STOP-XbaI dsOligo
- Build CMV:Kozak/V0120
- Knock-out FLAG from N-terminus - replace SpeI-CMV:FLAG:NLS-SacII with PCR-amplified (SpeI)/XbaI-CMV:Kozak-SpeI-NotI-SacII; use reverse primer to add SacII
STAGE 2 - histone parts
- Design histone components with RFC23 and SacII 3' in V0120
- Order primers
STAGE 3 - Cas assembly
- Replace SpeI-CMV:NLS:3xFLAG-SacII with SpeI-CMV:histonepart-SacII
STAGE 4 - gRNA
- Put pre-existing gRNA (from luc experiment) into pSPgRNA

Application
- Cas and gRNA plasmids will be co-transformed
- Analyze Cas protein via Western blot

Redesign dCas: design and order oligos for AscI-HA:STOP-EcoRI dsOligo

Cas47107_VP64ko top1 - 5'-CGCGCCATTAACTACCCGTACGACGTTCCGGACTACGCTTCTTGAGCGGCCGT
Cas47107_VP64ko btm - 5'-ctagACGGCCGCTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTAGTTAATGG

Design histone components with RFC23 and SacII 3' in V0120

RFC23prefix-H3_full:linker-SacII-RFC23suffix
RFC23prefix-H3_1-40:linker-SacII-RFC23suffix

Assemblies

BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size

Digests (Fermentas FD)
- Specific notes

Reagent	Volume
DNA (plasmid)	up to 25 μL
10x buffer	3.0
enzyme 1	1.0
enzyme 2	1.0
dH₂O	---
	30 μL --> 37°C/ ~30 min.

Measure conc.'s

Sample	OD260	260/280	ng/μL
1. Digested part (a/b)	---	---	---
2. Digested part (c/d)	---	---	---

Dephosphorylation (Roche)

Reagent	Volume
DNA (clean digest)	up to 17 μL (500 ng)
10x buffer d.p.	2.0
phosphatase	1.0
dH₂O	---
	20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL

Ligations

Ligation	Plate results (lig : neg crtl) mm/dd/yy
1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng	new BioBrick #:1 (Pick #)
2. vector(c/d)/ ## ng

	1	2
Insert DNA	###	---
Vector DNA	###	###
2x lgn buf (Roche)	###	###
T4 ligase (NEB)	1.0	1.0
dH₂O	###	###
	# μL	# μL

Oligo annealing

New BB 1
New BB 2

DNA (oligos, 100 μM)	up to 18 μL (3 μL ea.)
10x annealing buffer	2.0
dH₂O	---
	20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight

@@ Line 175: / Line 175: @@
 * Dig/Lig reactions
+** 2:1 ratio calculation: ~150 bp insert / ~4000 bp vector * 2 * 100 = '''3.75 ng insert'''
+# pAub-PCR(E/S dp) + AubR/MRV
+# pBja-PCR(E/S dp) + BjaR/MRV
+# pBra-PCR(E/S dp) + BraR/MRV
+# pRpa-PCR(E/S dp) + RpaR/MRV
+{| {{table}} cellspacing="3" <!-- Oligo annealing table -->
+|- valign="top"
+| bgcolor=#cfcfcf | Reagent
+| bgcolor=#cfcfcf | Rxn
+| bgcolor=#cfcfcf | Mix (x5)
+|-
+| 100 ng Vector || ### (up to 13.5) || ---
+|-
+| insert || 1.0 || ---
+|-
+| 10x FD buf || 2.0 || 10.0
+|-
+| 10 mM DTT || 1.0 || 5.0
+|-
+| 10 mM ATP || 1.0 || 5.0
+|-
+| FastDigest BbsI/BpiI || 1.0 || 5.0
+|-
+| Roche T4 DNA ligase || 0.5 || 2.5
+|-
+| dH<sub>2</sub>O || ### || ---
+|-
+| &nbsp; || 20.0
+|}
+--> Pipette 6.5 μL master mix into each PCR tube<br>
+--> Add 100 ng vector DNA<br>
+--> Add 13.5 - vector volume dH<sub>2</sub>O
+--> Mix by flicking
+LabNet OptiMax Thermocycler: '''BbsI Dig/Lig'''
+* 6x [37°C, 5 min; 23°C, 5 min]
+* 4°C, ∞
+Transformation(s)
+* Thaw 2 tubes chem competent DH5α-turbo on ice
+* Transfer 10.0 μL each ligation to fresh sterile 0.5 mL tube
+* Add 50 μL DH5α-turbo; pipette up-and-down 3x GENTLY
+* Incubate 5 min. on ice
+* Plate on 100 μg/mL amp
+** Split ligations in 1/2, do rapid protocol
+RESULTS (5/06/15)
+* tba

User:Karmella Haynes/Notebook/BioBrick cloning/2015/05/05: Difference between revisions

Revision as of 19:38, 5 May 2015

05/05/15

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

research

Tools