User:Karmella Haynes/Notebook/BioBrick cloning/2015/05/05

Karmella's BioBrick Cloning

Main project page Previous entry      Next entry

05/05/15 KAH87/MV10 - minipreps (5x 5mL) Ryan - clone-in Receiver promoters Cas-tone Project - plan assembly strategy, order primers Minipreps Sigma GenElute kit Elute w/ 75 μL elution sln. Check with NotI/XbaI digests Reagent Volume Expected: KAH87 fwd/MV10 = ~6150, 36, 28 KAH87 rev/MV10 = ~5100, 1089, 28 MV10 = ~5100, 36, 28 15 μL/lane; 1% agarose; Ladder DNA(plasmid) 2.0 μL 10X buffer 1.5 NotI 1.0 XbaI 1.0 dH2O 9.5   15 μL --> 37°C/ ~15 min. Measure conc.'s Sample OD260 260/280 ng/μL 1. KAH87/MV10-1 0.273 1.948 273.0 2. KAH87/MV10-2 0.341 1.940 341.5 3. KAH87/MV10-3 0.319 1.937 318.5 4. KAH87/MV10-4 0.248 1.948 248.1 Conclusions: Success! Clone #1,2,4 have forward insertion Discard - clone #3, reverse insertion Ryan - PCR & Dig/Lig (promoter insert trial #3) Ryan - Receiver plasmids, assembly - REVISED STRATEGY (PCR promoters) Stage 1 - insert Regulator ORFS Phusion PCR-amplify ORFs (add 5'-E, 3'-X cut sites) Insert ORF(E/X) into Vector (E/X). see Vector plasmid map Stage 2 - insert Promoters Phusion PCR-amplify promoter inserts (new primers) Cut promoters with E/S & dephos Insert promoters(E/S) into Vector/Regulator (BbsI) via Lig/Dig cycling Assemblies pAub/AubR/MRV: pAub(E/Xdp)/153 + AubR/MRV(BbsI)/4087 pBja/BjaR/MRV: pBja(E/Xdp)/122 + BjaR/MRV(BbsI)/3977 pBra/BraR/MRV: pBra(E/Xdp)/214 + BraR/MRV(BbsI)/3977 pRpa/RpaR/MRV: pRpa(E/Xdp)/136 + RpaR/MRV(BbsI)/3980 Vector concentrations (ng/μL) AubR/MRV, 257.7 BjaR/MRV, 177.3 BraR/MRV, 465.4 RpaR/MRV, 246.2 Phusion PCR-amplify promoters pAubR, EcoRI fwd, SpeI rev pBjaR, EcoRI fwd, SpeI rev pBraR, EcoRI fwd, SpeI rev pRpaR, EcoRI fwd, SpeI rev Reagent Vol Mix (x5) Expected: 1. pAubR = 153 2. pBjaR = 122 3. pBraR = 214 4. pRpaR = 136 5 μL/lane; 1% agarose; Ladder gBlock DNA (2 ng/μL) 0.5 --- 10 μM EcoRI fwd 1.0 5.0 10 μM SpeI rev 1.0 5.0 10 mM dNTPs 1.0 5.0 5x HF buffer 10.0 50.0 Phusion Pol. 0.5 2.5 dH2O 36.0 180.0   50.0 μL Thermal cycler: Bio-Rad - Phusion 98°C 3 min. 30x[98°C, 10 sec; 66°C 30 sec; 72°C 30 sec] 72°C 3 min. 4°C, ∞ Clean up PCR Qiagen PCR purification kit Elute w/ 30 μL elution buffer Measure conc.'s Sample OD260 260/280 ng/μL 1. pAubR PCR 0.021 1.707 20.8 2. pBjaR PCR 0.018 1.851 18.3 3. pBraR PCR 0.026 1.807 25.5 4. pRpaR PCR 0.018 1.720 17.8 Digests (Fermentas FD) Use clear FD buffer (no dye) Reagent Volume DNA (250 ng PCR) up to 16.0 10x clear FD buffer 2.0 EcoRI 1.0 SpeI 1.0 dH2O ---   20.0 μL --> 37°C/ ~15 min. Dephosphorylation (Roche) Add 1.0 SAP (Roche) to each rxn. 37°C/ 10 min.; 75°C/ 2 min.; [final] = 12.5 ng/μL Dig/Lig reactions 2:1 ratio calculation: ~150 bp insert / ~4000 bp vector * 2 * 100 = 3.75 ng insert pAub-PCR(E/S dp) + AubR/MRV pBja-PCR(E/S dp) + BjaR/MRV pBra-PCR(E/S dp) + BraR/MRV pRpa-PCR(E/S dp) + RpaR/MRV Reagent Rxn Mix (x5) 100 ng Vector ### (up to 13.5) --- insert 1.0 --- 10x FD buf 2.0 10.0 10 mM DTT 1.0 5.0 10 mM ATP 1.0 5.0 FastDigest BbsI/BpiI 1.0 5.0 Roche T4 DNA ligase 0.5 2.5 dH2O ### ---   20.0 --> Pipette 5.5 μL master mix into each PCR tube --> Add 1.0 μL insert into each tube --> Add 100 ng vector DNA --> Add x μL dH2O = 13.5 - vector volume --> Mix by flicking LabNet OptiMax Thermocycler: BbsI Dig/Lig 6x [37°C, 5 min; 23°C, 5 min] 4°C, ∞ Transformation(s) Thaw 2 tubes chem competent DH5α-turbo on ice Transfer 10.0 μL each ligation to fresh sterile 0.5 mL tube Add 50 μL DH5α-turbo; pipette up-and-down 3x GENTLY Incubate 5 min. on ice Plate on 100 μg/mL amp Split ligations in 1/2, do rapid protocol RESULTS (5/06/15) Success! ~50 colonies on the four assembly plates, ~10 colonies on a negative control (ligation mix, zero DNA) Streak plate and 5 mL cultures for two colonies from each assembly plate Cas-tone Project STAGE 1 - pcDNA-dCas9-VP64 vector re-design Knock-out VP64 from C-terminus - replace AscI-VP64:HA:STOP-EcoRI-XbaI with AscI-HA:STOP-XbaI dsOligo Build CMV:Kozak/V0120 Knock-out FLAG from N-terminus - replace SpeI-CMV:3xFLAG:NLS-SacII with PCR-amplified (SpeI)/XbaI-CMV-SpeI-NotI-SacII; use reverse primer to add SacII STAGE 2 - Histone parts PCR-clone histone parts as XbaI-Kozak-histone part-a-NotI. Note: Do no use Kozak BioBrick, since this will introduce unnatural amino acids onto conserved histone N-terminal tail Order primers STAGE 3 - Cas-fusion Insert Kozak-histone parts (X/N) into dCas9 (S/N) STAGE 4 - gRNA Put pre-existing gRNA (from luc experiment) into pSPgRNA Application Cas and gRNA plasmids will be co-transformed Analyze Cas protein via Western blot Knock-out VP64 from C-terminus Design and order oligos for AscI-HA:STOP-EcoRI dsOligo Cas47107_VP64ko top1 - 5'-CGCGCCATTAACTACCCGTACGACGTTCCGGACTACGCTTCTTGAGCGGCCGT Cas47107_VP64ko btm - 5'-ctagACGGCCGCTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTAGTTAATGG Knock-out FLAG from N-terminus Design and order oligos to PCR-amplify CMV XbaI-CMV f1 - 5'-CCTTTCTAGAGTTGACATTGATTATTGGCTAG SacII-NS-CMV r1 - 5'-CATTCCGCGGGCGGCCGCTACTAGTGAGCTCTGC