User:Karmella Haynes/Notebook/BioBrick cloning/2015/05/05: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(fix raw html notebook nav)
 
(19 intermediate revisions by one other user not shown)
Line 2: Line 2:
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
|-
|-
| colspan="2"|
| colspan="2"|
Line 24: Line 24:
| bgcolor=#cfcfcf | Volume  
| bgcolor=#cfcfcf | Volume  
| rowspan="7" | <u>Expected:</u><br>KAH87 fwd/MV10 = '''~6150''', 36, 28<br>KAH87 rev/MV10 = ~5100, '''1089''', 28<br>MV10 = ~5100, 36, 28<br>
| rowspan="7" | <u>Expected:</u><br>KAH87 fwd/MV10 = '''~6150''', 36, 28<br>KAH87 rev/MV10 = ~5100, '''1089''', 28<br>MV10 = ~5100, 36, 28<br>
| rowspan="7" | [[Image:Somegel.jpg|400px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder]
| rowspan="7" | [[Image:KAH050515_gel1.jpg|250px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder]
|-
|-
| DNA(plasmid) || 2.0 μL
| DNA(plasmid) || 2.0 μL
Line 38: Line 38:
| &nbsp; || 15 μL --> 37°C/ ~15 min.
| &nbsp; || 15 μL --> 37°C/ ~15 min.
|}
|}
* Measure conc.'s
{| {{table}} cellspacing="3" <!-- [DNA] table -->
|- bgcolor=#cfcfcf
| Sample || OD260 || 260/280 || ng/μL
|-
| 1. KAH87/MV10-1 || 0.273 || 1.948 || 273.0
|-
| 2. KAH87/MV10-2 || 0.341 || 1.940 || 341.5
|-
| 3. '''KAH87/MV10-3''' || 0.319 || 1.937 || 318.5
|-
| 4. KAH87/MV10-4 || 0.248 || 1.948 || 248.1
|}
Conclusions:
* Success! Clone #1,2,4 have forward insertion
* Discard - clone #3, reverse insertion




Line 68: Line 88:


* Phusion PCR-amplify promoters
* Phusion PCR-amplify promoters
# pAubR, EcoRI fwd, XbaI rev
# pAubR, EcoRI fwd, SpeI rev
# pBjaR, EcoRI fwd, XbaI rev
# pBjaR, EcoRI fwd, SpeI rev
# pBraR, EcoRI fwd, XbaI rev
# pBraR, EcoRI fwd, SpeI rev
# pRpaR, EcoRI fwd, XbaI rev
# pRpaR, EcoRI fwd, SpeI rev


{| {{table}} cellspacing="3" <!-- PCR rxn table -->
{| {{table}} cellspacing="3" <!-- PCR rxn table -->
Line 78: Line 98:
| bgcolor=#cfcfcf | Mix (x5)
| bgcolor=#cfcfcf | Mix (x5)
| rowspan=7 | Expected:<br>1. pAubR = 153<br>2. pBjaR = 122<br>3. pBraR = 214<br>4. pRpaR = 136
| rowspan=7 | Expected:<br>1. pAubR = 153<br>2. pBjaR = 122<br>3. pBraR = 214<br>4. pRpaR = 136
| rowspan=7 | [[Image:KAH042815_gel2.jpg|250px|Hover name]]<br>5 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder]
| rowspan=7 | [[Image:KAH050515_gel2.jpg|250px|Hover name]]<br>5 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder]
|-
|-
| gBlock DNA (2 ng/μL) || 0.5  || ---  
| gBlock DNA (2 ng/μL) || 0.5  || ---  
Line 99: Line 119:
Thermal cycler: Bio-Rad - Phusion
Thermal cycler: Bio-Rad - Phusion
* 98°C 3 min.
* 98°C 3 min.
* 30x[98°C, 30 sec; 66°C 30 sec; 72°C 30 sec]
* 30x[98°C, 10 sec; 66°C 30 sec; 72°C 30 sec]
* 72°C 3 min.
* 72°C 3 min.
* 4°C, ∞
* 4°C, ∞
Line 109: Line 129:




----
* Measure conc.'s
 
{| {{table}} cellspacing="3" <!-- [DNA] table -->
'''Cas-tone Project'''
|- bgcolor=#cfcfcf  
* STAGE 1 - pcDNA-dCas9-VP64 vector re-design
| Sample || OD260 || 260/280 || ng/μL
** Knock-out VP64 from C-terminus - replace AscI-VP64:HA:STOP-EcoRI-XbaI with AscI-HA:STOP-XbaI dsOligo
** Build CMV:Kozak/V0120
** Knock-out FLAG from N-terminus - replace SpeI-CMV:FLAG:NLS-SacII with PCR-amplified (SpeI)/XbaI-CMV:Kozak-SpeI-NotI-SacII; use reverse primer to add SacII
* STAGE 2 - histone parts
** Design histone components with RFC23 and SacII 3' in V0120
** Order primers
* STAGE 3 - Cas assembly
** Replace SpeI-CMV:NLS:3xFLAG-SacII with SpeI-CMV:histonepart-SacII
* STAGE 4 - gRNA
** Put pre-existing gRNA (from luc experiment) into pSPgRNA
 
* Application
** Cas and gRNA plasmids will be co-transformed
** Analyze Cas protein via Western blot
 
 
'''Redesign dCas: design and order oligos for AscI-HA:STOP-EcoRI dsOligo'''
# Cas47107_VP64ko top1 - 5'-CGCGCCATTAACTACCCGTACGACGTTCCGGACTACGCTTCTTGAGCGGCCGT
# Cas47107_VP64ko btm - 5'-ctagACGGCCGCTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTAGTTAATGG
 
 
'''Design histone components with RFC23 and SacII 3' in V0120'''
# RFC23prefix-H3_full:linker-SacII-RFC23suffix
# RFC23prefix-H3_1-40:linker-SacII-RFC23suffix
 
 
 
 
----
'''Minipreps'''<br>
* Check with E/P digests
 
{| {{table}} border="1" cellspacing="3" <!-- Digest check rxn. table -->
|- valign="top"
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Volume
| rowspan="7" | <u>Expected:</u><br>1. BB 1 = size<br>2. BB2 = size<br>
| rowspan="7" | <!-- [[Image:GelImage.jpg|400px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
|-
| DNA(plasmid) || 2.0 μL
|-
|-
| 10X buffer || 1.5
| 1. pAubR PCR || 0.021 || 1.707 || 20.8
|-
| EcoRI || 1.0
|-
|-
| PstI || 1.0
| 2. pBjaR PCR || 0.018 || 1.851 || 18.3
|-
|-
| dH<sub>2</sub>O || 9.5
| 3. pBraR PCR || 0.026 || 1.807 || 25.5
|-
|-
| &nbsp; || 15 μL --> 37°C/ ~15 min.
| 4. pRpaR PCR || 0.018 || 1.720 || 17.8
|}
|}


----
'''Assemblies'''
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
# BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size




* Digests (Fermentas FD)
* Digests (Fermentas FD)
** Specific notes
** Use clear FD buffer (no dye)


{| {{table}} cellspacing="3" <!-- Digest rxn. table -->
{| {{table}} cellspacing="3" <!-- Digest rxn. table -->
Line 178: Line 152:
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Volume
| bgcolor=#cfcfcf | Volume
| rowspan="7" | <!-- [[Image:GelImage.jpg|270px|Hover name]]<br>30 μL/lane, 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] -->
|-
|-
| DNA (plasmid) || up to 25 μL
| DNA (250 ng PCR) || up to 16.0
|-
|-
| 10x buffer || 3.0
| 10x clear FD buffer || 2.0
|-
|-
| enzyme 1 || 1.0
| EcoRI || 1.0
|-
|-
| enzyme 2 || 1.0
| SpeI || 1.0
|-
|-
| dH<sub>2</sub>O || ---
| dH<sub>2</sub>O || ---
|-
|-
| &nbsp; || 30 μL --> 37°C/ ~30 min.
| &nbsp; || 20.0 μL
|}
|}
--> 37°C/ ~15 min.
* Dephosphorylation (Roche)
** Add 1.0 SAP (Roche) to each rxn.
** 37°C/ 10 min.; 75°C/ 2 min.; [final] = 12.5 ng/μL




* Measure conc.'s
* Dig/Lig reactions
{| {{table}} cellspacing="3" <!-- [DNA] table -->
** 2:1 ratio calculation: ~150 bp insert / ~4000 bp vector * 2 * 100 = '''3.75 ng insert'''
|- bgcolor=#cfcfcf
# pAub-PCR(E/S dp) + AubR/MRV
| Sample || OD260 || 260/280 || ng/μL
# pBja-PCR(E/S dp) + BjaR/MRV
|-
# pBra-PCR(E/S dp) + BraR/MRV
| 1. Digested part (a/b) || --- || --- || ---
# pRpa-PCR(E/S dp) + RpaR/MRV
|-
| 2. Digested part (c/d) || --- || --- || ---
|}




* Dephosphorylation (Roche)
{| {{table}} cellspacing="3" <!-- Oligo annealing table -->
{| {{table}} cellspacing="3" <!-- Dephos table -->
|- valign="top"
|-
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Reagent
| bgcolor=#cfcfcf | Volume
| bgcolor=#cfcfcf | Rxn
| bgcolor=#cfcfcf | Mix (x5)
|-
|-
| DNA (clean digest) || up to 17 μL (500 ng)
| 100 ng Vector || ### (up to 13.5) || ---
|-
|-
| 10x buffer d.p. || 2.0
| insert || 1.0 || ---
|-
|-
| phosphatase || 1.0
| 10x FD buf || 2.0 || 10.0
|-
|-
| dH<sub>2</sub>O || ---
| 10 mM DTT || 1.0 || 5.0
|-
|-
| &nbsp; || 20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL
| 10 mM ATP || 1.0 || 5.0
|}
 
 
* Ligations
{| {{table}} cellspacing="3" <!-- Ligations table -->
|- bgcolor=#cfcfcf
| Ligation || <font color="blue"><u>Plate results (lig : neg crtl)</u> mm/dd/yy</font>
|-
| 1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng || <font color="blue">new BioBrick #:1 (Pick #)</font>
|-
| 2. vector(c/d)/ ## ng || &nbsp;
|}
 
{| {{table}} cellspacing="3" <!-- Ligation rxn table -->
| &nbsp;            || 1    || 2    ||
|-
| Insert DNA        || ###  || ---  ||
|-
| Vector DNA        || ###  || ###  ||
|-
|-
| 2x lgn buf (Roche) || ###  || ###  ||
| FastDigest BbsI/BpiI || 1.0 || 5.0
|-
|-
| T4 ligase (NEB)    || 1.0  || 1.0  ||
| Roche T4 DNA ligase || 0.5 || 2.5
|-
|-
| dH<sub>2</sub>O   || ### || ###  ||
| dH<sub>2</sub>O || ### || ---
|-
|-
| &nbsp;             || # μL || # μL ||
| &nbsp; || 20.0
|}
|}
--> Pipette 5.5 μL master mix into each PCR tube<br>
--> Add 1.0 μL insert into each tube<br>
--> Add 100 ng vector DNA<br>
--> Add x μL dH<sub>2</sub>O = 13.5 - vector volume <br>
--> Mix by flicking
LabNet OptiMax Thermocycler: '''BbsI Dig/Lig'''
* 6x [37°C, 5 min; 23°C, 5 min]
* 4°C, ∞
Transformation(s)
* Thaw 2 tubes chem competent DH5α-turbo on ice
* Transfer 10.0 μL each ligation to fresh sterile 0.5 mL tube
* Add 50 μL DH5α-turbo; pipette up-and-down 3x GENTLY
* Incubate 5 min. on ice
* Plate on 100 μg/mL amp
** Split ligations in 1/2, do rapid protocol
RESULTS (5/06/15)
* Success! ~50 colonies on the four assembly plates, ~10 colonies on a negative control (ligation mix, zero DNA)
* Streak plate and 5 mL cultures for two colonies from each assembly plate


----
----
'''Oligo annealing'''
# New BB 1
# New BB 2


{| class="wikitable" border="0" cellspacing="3" <!-- Oligo annealing rxn table -->
'''Cas-tone Project'''
| DNA (oligos, 100 μM) || up to 18 μL (3 μL ea.)
* STAGE 1 - pcDNA-dCas9-VP64 vector re-design
|-
** '''Knock-out VP64 from C-terminus - replace AscI-VP64:HA:STOP-EcoRI-XbaI with AscI-HA:STOP-XbaI dsOligo'''
| 10x annealing buffer || 2.0
** Build CMV:Kozak/V0120
|-
** '''Knock-out FLAG from N-terminus - replace SpeI-CMV:3xFLAG:NLS-SacII with PCR-amplified (SpeI)/XbaI-CMV-SpeI-NotI-SacII; use reverse primer to add SacII'''
| dH<sub>2</sub>O || ---
* STAGE 2 - Histone parts
|-
** PCR-clone histone parts as XbaI-Kozak-histone part-a-NotI. Note: Do no use Kozak BioBrick, since this will introduce unnatural amino acids onto conserved histone N-terminal tail
| &nbsp; || 20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight
** Order primers
|}
* STAGE 3 - Cas-fusion
** Insert Kozak-histone parts (X/N) into dCas9 (S/N)
* STAGE 4 - gRNA
** Put pre-existing gRNA (from luc experiment) into pSPgRNA
 
* Application
** Cas and gRNA plasmids will be co-transformed
** Analyze Cas protein via Western blot
 
 
'''Knock-out VP64 from C-terminus'''
* Design and order oligos for AscI-HA:STOP-EcoRI dsOligo
# Cas47107_VP64ko top1 - 5'-CGCGCCATTAACTACCCGTACGACGTTCCGGACTACGCTTCTTGAGCGGCCGT
# Cas47107_VP64ko btm - 5'-ctagACGGCCGCTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTAGTTAATGG
 
 
'''Knock-out FLAG from N-terminus'''
* Design and order oligos to PCR-amplify CMV
# XbaI-CMV f1 - 5'-CCTTTCTAGAGTTGACATTGATTATTGGCTAG
# SacII-NS-CMV r1 - 5'-CATTCCGCGGGCGGCCGCTACTAGTGAGCTCTGC
 
 
 
 




Latest revision as of 00:56, 27 September 2017

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

05/05/15

  • KAH87/MV10 - minipreps (5x 5mL)
  • Ryan - clone-in Receiver promoters
  • Cas-tone Project - plan assembly strategy, order primers


Minipreps

  • Sigma GenElute kit
  • Elute w/ 75 μL elution sln.
  • Check with NotI/XbaI digests
Reagent Volume Expected:
KAH87 fwd/MV10 = ~6150, 36, 28
KAH87 rev/MV10 = ~5100, 1089, 28
MV10 = ~5100, 36, 28
 Hover name
15 μL/lane; 1% agarose; Ladder
DNA(plasmid) 2.0 μL
10X buffer 1.5
NotI 1.0
XbaI 1.0
dH2O 9.5
  15 μL --> 37°C/ ~15 min.


  • Measure conc.'s
Sample OD260 260/280 ng/μL
1. KAH87/MV10-1 0.273 1.948 273.0
2. KAH87/MV10-2 0.341 1.940 341.5
3. KAH87/MV10-3 0.319 1.937 318.5
4. KAH87/MV10-4 0.248 1.948 248.1

Conclusions:

  • Success! Clone #1,2,4 have forward insertion
  • Discard - clone #3, reverse insertion


Ryan - PCR & Dig/Lig (promoter insert trial #3)

Ryan - Receiver plasmids, assembly - REVISED STRATEGY (PCR promoters)

  • Stage 1 - insert Regulator ORFS
    • Phusion PCR-amplify ORFs (add 5'-E, 3'-X cut sites)
    • Insert ORF(E/X) into Vector (E/X). see Vector plasmid map
  • Stage 2 - insert Promoters
    • Phusion PCR-amplify promoter inserts (new primers)
    • Cut promoters with E/S & dephos
    • Insert promoters(E/S) into Vector/Regulator (BbsI) via Lig/Dig cycling


Assemblies

  1. pAub/AubR/MRV: pAub(E/Xdp)/153 + AubR/MRV(BbsI)/4087
  2. pBja/BjaR/MRV: pBja(E/Xdp)/122 + BjaR/MRV(BbsI)/3977
  3. pBra/BraR/MRV: pBra(E/Xdp)/214 + BraR/MRV(BbsI)/3977
  4. pRpa/RpaR/MRV: pRpa(E/Xdp)/136 + RpaR/MRV(BbsI)/3980


  • Vector concentrations (ng/μL)
  1. AubR/MRV, 257.7
  2. BjaR/MRV, 177.3
  3. BraR/MRV, 465.4
  4. RpaR/MRV, 246.2


  • Phusion PCR-amplify promoters
  1. pAubR, EcoRI fwd, SpeI rev
  2. pBjaR, EcoRI fwd, SpeI rev
  3. pBraR, EcoRI fwd, SpeI rev
  4. pRpaR, EcoRI fwd, SpeI rev
Reagent Vol Mix (x5) Expected:
1. pAubR = 153
2. pBjaR = 122
3. pBraR = 214
4. pRpaR = 136 		Hover name
5 μL/lane; 1% agarose; Ladder
gBlock DNA (2 ng/μL) 0.5 ---
10 μM EcoRI fwd 1.0 5.0
10 μM SpeI rev 1.0 5.0
10 mM dNTPs 1.0 5.0
5x HF buffer 10.0 50.0
Phusion Pol. 0.5 2.5
dH2O 36.0 180.0
  50.0 μL

Thermal cycler: Bio-Rad - Phusion

  • 98°C 3 min.
  • 30x[98°C, 10 sec; 66°C 30 sec; 72°C 30 sec]
  • 72°C 3 min.
  • 4°C, ∞


  • Clean up PCR
    • Qiagen PCR purification kit
    • Elute w/ 30 μL elution buffer


  • Measure conc.'s
Sample OD260 260/280 ng/μL
1. pAubR PCR 0.021 1.707 20.8
2. pBjaR PCR 0.018 1.851 18.3
3. pBraR PCR 0.026 1.807 25.5
4. pRpaR PCR 0.018 1.720 17.8


  • Digests (Fermentas FD)
    • Use clear FD buffer (no dye)
Reagent Volume
DNA (250 ng PCR) up to 16.0
10x clear FD buffer 2.0
EcoRI 1.0
SpeI 1.0
dH2O ---
  20.0 μL

--> 37°C/ ~15 min.


  • Dephosphorylation (Roche)
    • Add 1.0 SAP (Roche) to each rxn.
    • 37°C/ 10 min.; 75°C/ 2 min.; [final] = 12.5 ng/μL


  • Dig/Lig reactions
    • 2:1 ratio calculation: ~150 bp insert / ~4000 bp vector * 2 * 100 = 3.75 ng insert
  1. pAub-PCR(E/S dp) + AubR/MRV
  2. pBja-PCR(E/S dp) + BjaR/MRV
  3. pBra-PCR(E/S dp) + BraR/MRV
  4. pRpa-PCR(E/S dp) + RpaR/MRV


Reagent Rxn Mix (x5)
100 ng Vector ### (up to 13.5) ---
insert 1.0 ---
10x FD buf 2.0 10.0
10 mM DTT 1.0 5.0
10 mM ATP 1.0 5.0
FastDigest BbsI/BpiI 1.0 5.0
Roche T4 DNA ligase 0.5 2.5
dH2O ### ---
  20.0

--> Pipette 5.5 μL master mix into each PCR tube
--> Add 1.0 μL insert into each tube
--> Add 100 ng vector DNA
--> Add x μL dH2O = 13.5 - vector volume
--> Mix by flicking

LabNet OptiMax Thermocycler: BbsI Dig/Lig

  • 6x [37°C, 5 min; 23°C, 5 min]
  • 4°C, ∞


Transformation(s)

  • Thaw 2 tubes chem competent DH5α-turbo on ice
  • Transfer 10.0 μL each ligation to fresh sterile 0.5 mL tube
  • Add 50 μL DH5α-turbo; pipette up-and-down 3x GENTLY
  • Incubate 5 min. on ice
  • Plate on 100 μg/mL amp
    • Split ligations in 1/2, do rapid protocol


RESULTS (5/06/15)

  • Success! ~50 colonies on the four assembly plates, ~10 colonies on a negative control (ligation mix, zero DNA)
  • Streak plate and 5 mL cultures for two colonies from each assembly plate


Cas-tone Project

  • STAGE 1 - pcDNA-dCas9-VP64 vector re-design
    • Knock-out VP64 from C-terminus - replace AscI-VP64:HA:STOP-EcoRI-XbaI with AscI-HA:STOP-XbaI dsOligo
    • Build CMV:Kozak/V0120
    • Knock-out FLAG from N-terminus - replace SpeI-CMV:3xFLAG:NLS-SacII with PCR-amplified (SpeI)/XbaI-CMV-SpeI-NotI-SacII; use reverse primer to add SacII
  • STAGE 2 - Histone parts
    • PCR-clone histone parts as XbaI-Kozak-histone part-a-NotI. Note: Do no use Kozak BioBrick, since this will introduce unnatural amino acids onto conserved histone N-terminal tail
    • Order primers
  • STAGE 3 - Cas-fusion
    • Insert Kozak-histone parts (X/N) into dCas9 (S/N)
  • STAGE 4 - gRNA
    • Put pre-existing gRNA (from luc experiment) into pSPgRNA
  • Application
    • Cas and gRNA plasmids will be co-transformed
    • Analyze Cas protein via Western blot


Knock-out VP64 from C-terminus

  • Design and order oligos for AscI-HA:STOP-EcoRI dsOligo
  1. Cas47107_VP64ko top1 - 5'-CGCGCCATTAACTACCCGTACGACGTTCCGGACTACGCTTCTTGAGCGGCCGT
  2. Cas47107_VP64ko btm - 5'-ctagACGGCCGCTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTAGTTAATGG


Knock-out FLAG from N-terminus

  • Design and order oligos to PCR-amplify CMV
  1. XbaI-CMV f1 - 5'-CCTTTCTAGAGTTGACATTGATTATTGGCTAG
  2. SacII-NS-CMV r1 - 5'-CATTCCGCGGGCGGCCGCTACTAGTGAGCTCTGC





Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Karmella_Haynes/Notebook/BioBrick_cloning/2015/05/05&oldid=1016803"