User:Karmella Haynes/Notebook/BioBrick cloning/2015/05/05: Difference between revisions
From OpenWetWare
(fix raw html notebook nav) |
|||
(19 intermediate revisions by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Line 24: | Line 24: | ||
| bgcolor=#cfcfcf | Volume | | bgcolor=#cfcfcf | Volume | ||
| rowspan="7" | <u>Expected:</u><br>KAH87 fwd/MV10 = '''~6150''', 36, 28<br>KAH87 rev/MV10 = ~5100, '''1089''', 28<br>MV10 = ~5100, 36, 28<br> | | rowspan="7" | <u>Expected:</u><br>KAH87 fwd/MV10 = '''~6150''', 36, 28<br>KAH87 rev/MV10 = ~5100, '''1089''', 28<br>MV10 = ~5100, 36, 28<br> | ||
| rowspan="7" | [[Image: | | rowspan="7" | [[Image:KAH050515_gel1.jpg|250px|Hover name]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] | ||
|- | |- | ||
| DNA(plasmid) || 2.0 μL | | DNA(plasmid) || 2.0 μL | ||
Line 38: | Line 38: | ||
| || 15 μL --> 37°C/ ~15 min. | | || 15 μL --> 37°C/ ~15 min. | ||
|} | |} | ||
* Measure conc.'s | |||
{| {{table}} cellspacing="3" <!-- [DNA] table --> | |||
|- bgcolor=#cfcfcf | |||
| Sample || OD260 || 260/280 || ng/μL | |||
|- | |||
| 1. KAH87/MV10-1 || 0.273 || 1.948 || 273.0 | |||
|- | |||
| 2. KAH87/MV10-2 || 0.341 || 1.940 || 341.5 | |||
|- | |||
| 3. '''KAH87/MV10-3''' || 0.319 || 1.937 || 318.5 | |||
|- | |||
| 4. KAH87/MV10-4 || 0.248 || 1.948 || 248.1 | |||
|} | |||
Conclusions: | |||
* Success! Clone #1,2,4 have forward insertion | |||
* Discard - clone #3, reverse insertion | |||
Line 68: | Line 88: | ||
* Phusion PCR-amplify promoters | * Phusion PCR-amplify promoters | ||
# pAubR, EcoRI fwd, | # pAubR, EcoRI fwd, SpeI rev | ||
# pBjaR, EcoRI fwd, | # pBjaR, EcoRI fwd, SpeI rev | ||
# pBraR, EcoRI fwd, | # pBraR, EcoRI fwd, SpeI rev | ||
# pRpaR, EcoRI fwd, | # pRpaR, EcoRI fwd, SpeI rev | ||
{| {{table}} cellspacing="3" <!-- PCR rxn table --> | {| {{table}} cellspacing="3" <!-- PCR rxn table --> | ||
Line 78: | Line 98: | ||
| bgcolor=#cfcfcf | Mix (x5) | | bgcolor=#cfcfcf | Mix (x5) | ||
| rowspan=7 | Expected:<br>1. pAubR = 153<br>2. pBjaR = 122<br>3. pBraR = 214<br>4. pRpaR = 136 | | rowspan=7 | Expected:<br>1. pAubR = 153<br>2. pBjaR = 122<br>3. pBraR = 214<br>4. pRpaR = 136 | ||
| rowspan=7 | [[Image: | | rowspan=7 | [[Image:KAH050515_gel2.jpg|250px|Hover name]]<br>5 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder] | ||
|- | |- | ||
| gBlock DNA (2 ng/μL) || 0.5 || --- | | gBlock DNA (2 ng/μL) || 0.5 || --- | ||
Line 99: | Line 119: | ||
Thermal cycler: Bio-Rad - Phusion | Thermal cycler: Bio-Rad - Phusion | ||
* 98°C 3 min. | * 98°C 3 min. | ||
* 30x[98°C, | * 30x[98°C, 10 sec; 66°C 30 sec; 72°C 30 sec] | ||
* 72°C 3 min. | * 72°C 3 min. | ||
* 4°C, ∞ | * 4°C, ∞ | ||
Line 109: | Line 129: | ||
* Measure conc.'s | |||
{| {{table}} cellspacing="3" <!-- [DNA] table --> | |||
|- bgcolor=#cfcfcf | |||
* | | Sample || OD260 || 260/280 || ng/μL | ||
{| {{table}} | |||
|- | |||
| | |||
| | |||
|- | |- | ||
| | | 1. pAubR PCR || 0.021 || 1.707 || 20.8 | ||
| | |||
| | |||
|- | |- | ||
| | | 2. pBjaR PCR || 0.018 || 1.851 || 18.3 | ||
|- | |- | ||
| | | 3. pBraR PCR || 0.026 || 1.807 || 25.5 | ||
|- | |- | ||
| | | 4. pRpaR PCR || 0.018 || 1.720 || 17.8 | ||
|} | |} | ||
* Digests (Fermentas FD) | * Digests (Fermentas FD) | ||
** | ** Use clear FD buffer (no dye) | ||
{| {{table}} cellspacing="3" <!-- Digest rxn. table --> | {| {{table}} cellspacing="3" <!-- Digest rxn. table --> | ||
Line 178: | Line 152: | ||
| bgcolor=#cfcfcf | Reagent | | bgcolor=#cfcfcf | Reagent | ||
| bgcolor=#cfcfcf | Volume | | bgcolor=#cfcfcf | Volume | ||
|- | |- | ||
| DNA ( | | DNA (250 ng PCR) || up to 16.0 | ||
|- | |- | ||
| 10x buffer || | | 10x clear FD buffer || 2.0 | ||
|- | |- | ||
| | | EcoRI || 1.0 | ||
|- | |- | ||
| | | SpeI || 1.0 | ||
|- | |- | ||
| dH<sub>2</sub>O || --- | | dH<sub>2</sub>O || --- | ||
|- | |- | ||
| || | | || 20.0 μL | ||
|} | |} | ||
--> 37°C/ ~15 min. | |||
* Dephosphorylation (Roche) | |||
** Add 1.0 SAP (Roche) to each rxn. | |||
** 37°C/ 10 min.; 75°C/ 2 min.; [final] = 12.5 ng/μL | |||
* | * Dig/Lig reactions | ||
** 2:1 ratio calculation: ~150 bp insert / ~4000 bp vector * 2 * 100 = '''3.75 ng insert''' | |||
# pAub-PCR(E/S dp) + AubR/MRV | |||
# pBja-PCR(E/S dp) + BjaR/MRV | |||
# pBra-PCR(E/S dp) + BraR/MRV | |||
# pRpa-PCR(E/S dp) + RpaR/MRV | |||
{| {{table}} cellspacing="3" <!-- Oligo annealing table --> | |||
{| {{table}} cellspacing="3" <!-- | |- valign="top" | ||
|- | |||
| bgcolor=#cfcfcf | Reagent | | bgcolor=#cfcfcf | Reagent | ||
| bgcolor=#cfcfcf | | | bgcolor=#cfcfcf | Rxn | ||
| bgcolor=#cfcfcf | Mix (x5) | |||
|- | |- | ||
| | | 100 ng Vector || ### (up to 13.5) || --- | ||
|- | |- | ||
| | | insert || 1.0 || --- | ||
|- | |- | ||
| | | 10x FD buf || 2.0 || 10.0 | ||
|- | |- | ||
| | | 10 mM DTT || 1.0 || 5.0 | ||
|- | |- | ||
| | | 10 mM ATP || 1.0 || 5.0 | ||
| | |||
| 1. | |||
|- | |- | ||
| | | FastDigest BbsI/BpiI || 1.0 || 5.0 | ||
|- | |- | ||
| T4 ligase | | Roche T4 DNA ligase || 0.5 || 2.5 | ||
|- | |- | ||
| dH<sub>2</sub>O | | dH<sub>2</sub>O || ### || --- | ||
|- | |- | ||
| | | || 20.0 | ||
|} | |} | ||
--> Pipette 5.5 μL master mix into each PCR tube<br> | |||
--> Add 1.0 μL insert into each tube<br> | |||
--> Add 100 ng vector DNA<br> | |||
--> Add x μL dH<sub>2</sub>O = 13.5 - vector volume <br> | |||
--> Mix by flicking | |||
LabNet OptiMax Thermocycler: '''BbsI Dig/Lig''' | |||
* 6x [37°C, 5 min; 23°C, 5 min] | |||
* 4°C, ∞ | |||
Transformation(s) | |||
* Thaw 2 tubes chem competent DH5α-turbo on ice | |||
* Transfer 10.0 μL each ligation to fresh sterile 0.5 mL tube | |||
* Add 50 μL DH5α-turbo; pipette up-and-down 3x GENTLY | |||
* Incubate 5 min. on ice | |||
* Plate on 100 μg/mL amp | |||
** Split ligations in 1/2, do rapid protocol | |||
RESULTS (5/06/15) | |||
* Success! ~50 colonies on the four assembly plates, ~10 colonies on a negative control (ligation mix, zero DNA) | |||
* Streak plate and 5 mL cultures for two colonies from each assembly plate | |||
---- | ---- | ||
'''Cas-tone Project''' | |||
* STAGE 1 - pcDNA-dCas9-VP64 vector re-design | |||
** '''Knock-out VP64 from C-terminus - replace AscI-VP64:HA:STOP-EcoRI-XbaI with AscI-HA:STOP-XbaI dsOligo''' | |||
** Build CMV:Kozak/V0120 | |||
** '''Knock-out FLAG from N-terminus - replace SpeI-CMV:3xFLAG:NLS-SacII with PCR-amplified (SpeI)/XbaI-CMV-SpeI-NotI-SacII; use reverse primer to add SacII''' | |||
* STAGE 2 - Histone parts | |||
** PCR-clone histone parts as XbaI-Kozak-histone part-a-NotI. Note: Do no use Kozak BioBrick, since this will introduce unnatural amino acids onto conserved histone N-terminal tail | |||
** Order primers | |||
* STAGE 3 - Cas-fusion | |||
** Insert Kozak-histone parts (X/N) into dCas9 (S/N) | |||
* STAGE 4 - gRNA | |||
** Put pre-existing gRNA (from luc experiment) into pSPgRNA | |||
* Application | |||
** Cas and gRNA plasmids will be co-transformed | |||
** Analyze Cas protein via Western blot | |||
'''Knock-out VP64 from C-terminus''' | |||
* Design and order oligos for AscI-HA:STOP-EcoRI dsOligo | |||
# Cas47107_VP64ko top1 - 5'-CGCGCCATTAACTACCCGTACGACGTTCCGGACTACGCTTCTTGAGCGGCCGT | |||
# Cas47107_VP64ko btm - 5'-ctagACGGCCGCTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTAGTTAATGG | |||
'''Knock-out FLAG from N-terminus''' | |||
* Design and order oligos to PCR-amplify CMV | |||
# XbaI-CMV f1 - 5'-CCTTTCTAGAGTTGACATTGATTATTGGCTAG | |||
# SacII-NS-CMV r1 - 5'-CATTCCGCGGGCGGCCGCTACTAGTGAGCTCTGC | |||
Latest revision as of 00:56, 27 September 2017
Karmella's BioBrick Cloning | Main project page Previous entry Next entry | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
05/05/15
Minipreps
Conclusions:
Ryan - PCR & Dig/Lig (promoter insert trial #3) Ryan - Receiver plasmids, assembly - REVISED STRATEGY (PCR promoters)
Thermal cycler: Bio-Rad - Phusion
--> 37°C/ ~15 min.
--> Pipette 5.5 μL master mix into each PCR tube LabNet OptiMax Thermocycler: BbsI Dig/Lig
RESULTS (5/06/15)
Cas-tone Project
|