User:Karmella Haynes/Notebook/BioBrick cloning/2015/03/19: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 26: Line 26:
** LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc]
** LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc]


* Note: Each [side] of the LCR bridge oligo should have a Tm of 60C (de Kok 2014)
* Note: Each [side] of the LCR bridge oligo should have a Tm of 60°C (de Kok 2014)
* The LCR oligos shown here are the reverse complement of the coding strand(s)
* The LCR oligos shown here are the reverse complement of the coding strand(s)



Revision as of 16:43, 19 March 2015

Karmella's BioBrick Cloning <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

03/19/15

  • Gal4DB fusions - new strategy
  • Plasmid preps - overnight cultures

Gal4DB fusion - new strategy

  • Build entire constructs via LCR using these as parts...
    • MV10 - XbaI-cut, contains CMV promoter, XabI, and NLS-6his-stop
    • Gal4DB-mCh - 459 bp - PCR from KAH228, 5'p oligos
    • Activation Domain - 159-4428 bp - PCR from cDNA, 5'p oligos
  • Next step - order oligos
    • Gal4DB f / 5'p, 5'-atgaagctactgtcttctat
    • mCh r / 5'p, 5'-cttgtacagctcgtccatgc
    • LCRb_MV10_Gal4DB_rc, 5'-[tgcttgttcgatagaagacagtagcttcat][ctccatggtggcggcggg]
    • LCRb_mCh_ATF2, 5'-[gtgctggaccaaatttcagtgtcatctc][cttgtacagctcgtccatgccg]
    • LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc]
  • Note: Each [side] of the LCR bridge oligo should have a Tm of 60°C (de Kok 2014)
  • The LCR oligos shown here are the reverse complement of the coding strand(s)




Minipreps

  • Check with E/P digests
Reagent Volume Expected:
1. BB 1 = size
2. BB2 = size
DNA(plasmid) 2.0 μL
10X buffer 1.5
EcoRI 1.0
PstI 1.0
dH2O 9.5
  15 μL --> 37°C/ ~15 min.

Assemblies

  1. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size
  2. BioBrick name: 5' part/(a/b)/size + 3' part/(c/d)/size


  • Digests (Fermentas FD)
    • Specific notes
Reagent Volume
DNA (plasmid) up to 25 μL
10x buffer 3.0
enzyme 1 1.0
enzyme 2 1.0
dH2O ---
  30 μL --> 37°C/ ~30 min.


  • Measure conc.'s
Sample OD260 260/280 ng/μL
1. Digested part (a/b) --- --- ---
2. Digested part (c/d) --- --- ---


  • Dephosphorylation (Roche)
Reagent Volume
DNA (clean digest) up to 17 μL (500 ng)
10x buffer d.p. 2.0
phosphatase 1.0
dH2O ---
  20 μL --> 37°C/ 10 min.; 75°C/ 2 min.; [final] = 25 ng/μL


  • Ligations
Ligation Plate results (lig : neg crtl) mm/dd/yy
1. insert(a/b)/size, ## ng + vector(c/d)/size, ## ng new BioBrick #:1 (Pick #)
2. vector(c/d)/ ## ng  
  1 2
Insert DNA ### ---
Vector DNA ### ###
2x lgn buf (Roche) ### ###
T4 ligase (NEB) 1.0 1.0
dH2O ### ###
  # μL # μL

Oligo annealing

  1. New BB 1
  2. New BB 2
DNA (oligos, 100 μM) up to 18 μL (3 μL ea.)
10x annealing buffer 2.0
dH2O ---
  20 μL --> 100°C (water bath)/ 5 min.; Cool to R.T. overnight