User:Karmella Haynes/Notebook/BioBrick cloning/2015/03/19: Difference between revisions
From OpenWetWare
Line 26: | Line 26: | ||
** LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc] | ** LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc] | ||
* Note: Each [side] of the LCR bridge oligo should have a Tm of | * Note: Each [side] of the LCR bridge oligo should have a Tm of 60°C (de Kok 2014) | ||
* The LCR oligos shown here are the reverse complement of the coding strand(s) | * The LCR oligos shown here are the reverse complement of the coding strand(s) | ||
Revision as of 16:43, 19 March 2015
Karmella's BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
03/19/15
Gal4DB fusion - new strategy
Minipreps
Assemblies
Oligo annealing
|