User:Karmella Haynes/Notebook/BioBrick cloning/2015/03/19: Difference between revisions
From OpenWetWare
Line 22: | Line 22: | ||
** Gal4DB f / 5'p, 5'-atgaagctactgtcttctat | ** Gal4DB f / 5'p, 5'-atgaagctactgtcttctat | ||
** mCh r / 5'p, 5'-cttgtacagctcgtccatgc | ** mCh r / 5'p, 5'-cttgtacagctcgtccatgc | ||
** | ** LCRb_MV10_Gal4DB_rc, 5'-[tgcttgttcgatagaagacagtagcttcat][ctccatggtggcggcggg] | ||
** LCRb_mCh_ATF2, 5'- | ** LCRb_mCh_ATF2, 5'-[gtgctggaccaaatttcagtgtcatctc][cttgtacagctcgtccatgccg] | ||
** LCRb_ATF2_MV10, 5'- | ** LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc] | ||
* Note: Each [side] of the LCR bridge oligo should have a Tm of 60C (de Kok 2014) | |||
* The LCR oligos shown here are the reverse complement of the coding strand(s) | |||
Revision as of 16:15, 19 March 2015
Karmella's BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
03/19/15
Gal4DB fusion - new strategy
Minipreps
Assemblies
Oligo annealing
|