User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02

From OpenWetWare

< User:Karmella Haynes | Notebook | BioBrick cloning | 2013 | 01(Difference between revisions)
Jump to: navigation, search
(01/02/13)
Current revision (21:03, 2 January 2013) (view source)
(01/02/13)
 
Line 38: Line 38:
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg
# gg_BL01 F: 5'-'''cgtctc'''atggagctttcagcggtggg
# gg_BL01 F: 5'-'''cgtctc'''atggagctttcagcggtggg
-
# gg_BL01-BBS R: 5'-'''cgtctc'''CTAGT
+
# gg_BL01-BBS R: 5'-'''cgtctc'''CTAGTgccaggatcccccgagcccc
 +
 
 +
 

Current revision

Karmella's BioBrick Cloning Main project page
Previous entry      Next entry

01/02/13

  • Gibson assembly: order primers for vector pSB1A3
  • Golden Gate assembly: order primers for pSB1A3 and Brady's parts
  • Order enzyme for Golden gate assembly: BsmBI



Gibson Assembly design

  • Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly.
  • Retry assembly "hPCD-BL01" (see [1]). Make sure primer sequence overlaps with Brady's external sequences:
    • BBP-hPCD fwd: gaattcgcggccgcttctaga-tggagctttcagcggtggg (first 21 = BioBrick prefix)
    • BL01-BBS rev: ctgcagcggccgctactagt-gccaggatcccccgagcccc (first 20 = BioBrick suffix)

New primers designed to amplify pSB1A3 backbone (should also work for V0120)

  1. Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix)
  2. Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix)


Golden Gate design

  • Use BsmBI, per Dave Savage's recommendation
    • cgtctc - 5bp overlap - part - 5bp overlap - gcagaga
    • Forward - 5'-cgtctc NNNNN+20bp TOP
    • Reverse - 5'-cgtctc nnnnn+20bp rev comp

New primers

  1. gg_BBS F: 5'-cgtctcactagtagcggccgctgcag (should also work for V0120)
  2. gg_BBP R: 5'-cgtctctctagatgcggccgcgaattc (should also work for V0120)
  3. gg_BBP-hPCD F: 5'-cgtctcCTAGAtggagctttcagcggtggg
  4. gg_hPCD-BL01 R: 5'-cgtctcTCCATtctttccctttcctcaaagg
  5. gg_BL01 F: 5'-cgtctcatggagctttcagcggtggg
  6. gg_BL01-BBS R: 5'-cgtctcCTAGTgccaggatcccccgagcccc






Personal tools