User:Karmella Haynes/Notebook/BioBrick cloning/2013/01/02: Difference between revisions
From OpenWetWare
(fix raw html notebook nav) |
|||
(4 intermediate revisions by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;">Karmella's BioBrick Cloning</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Line 10: | Line 10: | ||
* Gibson assembly: order primers for vector pSB1A3 | * Gibson assembly: order primers for vector pSB1A3 | ||
* Golden Gate assembly: order primers for pSB1A3 and Brady's parts | * Golden Gate assembly: order primers for pSB1A3 and Brady's parts | ||
* Order enzyme for Golden gate assembly: | * Order enzyme for Golden gate assembly: BsmBI | ||
---- | ---- | ||
'''Gibson Assembly design''' | '''Gibson Assembly design''' | ||
* Previously tried to ligate Gibson insert into X/S-cut pSB1A3, unsuccessful. This time, PCR everything, including the vector, then do Gibson assembly. | |||
* Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: | * Retry assembly "hPCD-BL01" (see [http://openwetware.org/wiki/Haynes_Lab:Notebook/Engineering_PC-TFs/2012/12/07]). Make sure primer sequence overlaps with Brady's external sequences: | ||
** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) | ** BBP-hPCD fwd: '''gaattcgcggccgcttctaga'''-tggagctttcagcggtggg (first 21 = BioBrick prefix) | ||
** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix) | ** BL01-BBS rev: '''ctgcagcggccgctactagt'''-gccaggatcccccgagcccc (first 20 = BioBrick suffix) | ||
# | |||
New primers designed to amplify pSB1A3 backbone (should also work for V0120) | |||
# Gib_BBS F: 5'-actagtagcggccgctgcag (forward seq from the BB suffix) | |||
# Gib_BBP R: 5'-tctagatgcggccgcgaattc (reverse seq from the BB prefix) | |||
'''Golden Gate design''' | |||
* Use '''BsmBI''', per Dave Savage's recommendation | |||
** cgtctc - 5bp overlap - part - 5bp overlap - gcagaga | |||
** Forward - 5'-cgtctc NNNNN+20bp TOP | |||
** Reverse - 5'-cgtctc nnnnn+20bp rev comp | |||
New primers | |||
# gg_BBS F: 5'-'''cgtctc'''actagtagcggccgctgcag (should also work for V0120) | |||
# gg_BBP R: 5'-'''cgtctc'''tctagatgcggccgcgaattc (should also work for V0120) | |||
# gg_BBP-hPCD F: 5'-'''cgtctc'''CTAGAtggagctttcagcggtggg | |||
# gg_hPCD-BL01 R: 5'-'''cgtctc'''TCCATtctttccctttcctcaaagg | |||
# gg_BL01 F: 5'-'''cgtctc'''atggagctttcagcggtggg | |||
# gg_BL01-BBS R: 5'-'''cgtctc'''CTAGTgccaggatcccccgagcccc | |||
Latest revision as of 22:20, 26 September 2017
Karmella's BioBrick Cloning | Main project page Previous entry Next entry |
01/02/13
Gibson Assembly design
New primers designed to amplify pSB1A3 backbone (should also work for V0120)
Golden Gate design
New primers
|