User:Jessho

From OpenWetWare

Revision as of 17:25, 12 November 2008 by Jessho (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Basics

Last name: Ho
First name: Jessica
Course/Minor: 20 and 8B. No minor, yet.
Email:jessho AT mit DOT edu

Have you taken or are you taking...
Completed 7.05/5.07 (Biochemistry)
Enrolled 7.06 (Cell Biology)
No 7.02 (General Biology Lab)
No 5.310 (General Chemistry Lab)

Do you have any experience culturing cells (mammalian, yeast or microbial)? Yes

Do you have any experience in molecular biology (electrophoresis, PCR, etc)? Yes

Please briefly describe any previous laboratory experience
Undergrad team member, MIT iGEM 2007 team
UROP, June 08 - Present, Lauffenburger Lab

20.109 Mod 2 - SAGA-Related info

My Favorite Protein: YJR097W

Primer Design

Purpose: To design a primer to amplify a TAP TRP1 fusion gene. After PCR, the fusion gene will have additional elements, i.e. homologous regions of the S. cerivisiae gene YGR097W flanking the TAP TRP1 gene, to enable C-terminus modification of YGR097W via homologous recombination.

Forward: 5’- AAGGTTAATTTTGACATCGAGGAAGAGCAAGAAGGACAA TCC ATG GAA AAG AGA AGA TG - 3'

Backward: 5'- AGATTTATCTGATATGCTCAATTTCCCCTCCCATTTTCA GAC TCA CTA TAG GGC GA - 3'

20.109 Mod 3 Research Proposal

Investigating the proteins with which extracellular Hsp90 interacts. Click here for more info

Personal tools