User:Jarle Pahr/Sequencing

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(File formats)
Line 129: Line 129:
See also
=Sequencing services=
=Sequencing services=

Revision as of 19:47, 27 March 2013

Nature focus issue - sequencing technology:



For a comparison of next-generation sequencing methods, see

Sanger sequencing (chain termination method)

Pyrosequencing ("454 sequencing")

Pyrosequencing is a "sequence by synthesis" method developed by Mostafa Ronaghi and Pål Nyrén at the Royal Institute of Technology, Stockholm. Sequences are determined by observation of light emission upon addition of a nucleotide complementary to the first unpaired nucleotide of the template.

Quote from Wikipedia:Pyrosequencing:

"ssDNA template is hybridized to a sequencing primer and incubated with the enzymes DNA polymerase, ATP sulfurylase, luciferase and apyrase, and with the substrates adenosine 5´ phosphosulfate (APS) and luciferin."

Sequencing proceeds as follows:

  • Addition of one of the four dNTPs (dATPαS is substituted for ATP, as the former is not a substrate for luciferase). If the dNTP is complementary, DNA polyerase incorporates the nucleotide, releasing pyrophosphate (PPi).
  • ATP sulfurylase catalyzes reaction of PPi and adenosine 5' phosphosulfate to create ATP
  • ATP fuels luciferase-catalyzed conversion of luciferin to oxyluceferin, generating visible light.
  • Unincorporated nucleotides and ATP are degraded by apyrase.

454 sequencing performs massively parallel pyrosequencing. Library DNA containing adapter sequences are adsorbed to DNA-capturing beads. The DNA bound to each bead is then amplified by emulsion-PCR, in which the beads with bound DNA are mixed with PCR reagents and emulsion oil to create a water-in-oil emulsion containing many "microreactors" consisting of beads sorrounded by water. Following PCR amplification, the DNA-binding beads are isolated and deposited into the wells of a microtiter plate. Beads with pyrosequencing enzymes are then added to the plate. Finally, the pyrosequencing is performed, processing the plate in a sequencing machine. 400 000+ DNA fragments/beads can be processed per plate.

Using "multiplex identifiers", different genomic libraries can be bar-coded, facilitating sequencing of several libraries in the same sequencing run.


Platform Throughput (bases/run) Time per run Average (a)/mode (m) read length (nt) AccuracyIntroduced (year)
GS FLX+ 700 Mbp 23h Up to 1000 700 bp (m)
GS Junior 35Mbp 12 h 400 400 bp (a) at Phred20/read



Introductory paper, 454 sequencing:

The development and impact of 454 sequencing

Direct Comparisons of Illumina vs. Roche 454 Sequencing Technologies on the Same Microbial Community DNA Sample

Overview of 454 sequencing:

Illumina (Solexa) sequencing

Platform Throughput (bases/run) (maximum) Time per run Read length (nt) Accuracy Features Introduced (year)
MiSeq Personal Sequencer Up to 8.5 gbp 4 - 48 h 250 >70% bases higher than Q30 at read length 2 x 300 bp
HiSeq 2500/1500600 Gb 2 x 100 >80 % higher than Q30
HiSeq 2000/1000300 Gb 2 x 100 >80 % higher than Q30
Genome Analyzer IIx95 Gb 2 x 150 >80 % higher than Q30

MiSeq datasheet:

Side by side comparison of Illumina sequencers:

Illumina - an introduction to NGS:

Ion semiconductor sequencing

Ion Torrent: Platforms:

Platform Throughput (bases/run) Time per run Typical read length Accuracy Introduced (year)
Ion PGM sequencer 10 Mb to 1Gb 90 min+ 35-400 bp
Ion Proton sequencer 1 human genome2h+ 100 bp

Nanopore sequencing

Oxford Nanopore:

Single molecule real time sequencing (Pacific Biosciences)

Microscopical wells on a chip (zero-mode waveguides) each contain a single DNA polymerase enzyme bound to the bottom of the well, which accept a single DNA molecule as template. Fluorescent labelled dNTPs are used for DNA synthesis. Upon incorporation of a dNTP, the fluorescence tag is cleaved from the nucleotide and diffuses from the observation area within the ZMW. The sequence is determined optically by observing incorporation events.

SOLiD sequencing (Applied Biosystems)

DNA nanoball sequencing


Targeted sequencing

Targeted "capturing kits" may be used to sequence a subset of genomic DNA. The human exome (as defined by the Consensus CDS (CCDS) project) totals about 38 Mb, covering about 1.22 % of the human genome

(The SureSelect Human All Exon Kit )

Paired-end reads


See also

Sequencing services

Service Sample specification Primer specification Ship to Link
GATC LightRun Add 5 uL DNA (80-100 ng/uL plasmid or 20-80 ng/uL purified PCR product) + 5 uL 5uM (5 pmol/uL) primer to the same tube Tm 52-58 C, 17-19 bp, (8-9 G+C for 18-mer) G or C at 3' end (max 3 Gs or Cs), maximum 4bp run. GATC Biotech AG. European Custom Sequencing Centre. Gotrfied-Hagen-Strasse 20. 51105 Köln.
Macrogen Single-pass Add 20 uL DNA (100 ng/uL plasmid or 50 ng/uL purified PCR product) to one tube. Add 20µl primer (10 pmol/uL) to a separate tube. 18-25 bp, 40-60 % GC, Tm 55-60 Macrogen Europe,

IWO, Kamer IA3-195, Meibergdreef 39,1105 AZ Amsterdam Zuid-oost. Netherlands. Attention: J.S .Park.

Sequencing-based techniques


Sequencing centres


New York Genome Center:


Custom primers

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
pJP-1_seq5 18CAGCGTGCGAGTGATTAT 53.9/60.6 (2)/52.6 (3) 50 Binds upstream of XylS region in pSB-M1g
pJP-1_seq618AGACCACATGGTCCTTCT 57.5° (2)/52.8 ºC(3) 53.9 50 Binds near end of GFPmut3 in pSB-M1g
SeqMG1 AGCAGATCCACATCCTTGAA62.7 (2)/53.7 (3) Binds at nt 5672 of pSB-M1g, upstream of AgeI site. Designed to Macrogen sequencing primer criteria.
pSB-SeqA18TGCAAGAAGCGGATACAG56 / 60.7°C (2)/52.3 ºC (3) 50Binds at nt 7729 of pSB-M1g, upstream of Pm promoter and PciI site.

Universal primers

Tm calculations: 1: CloneManager 2: Thermo Scientific 3: IDT Oligoanalyzer

A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers


Chromatogram viewers:

CodonCode aligner:



About SCF (sequence chromatogram format) files:

SAM tools:

Maq: Mapping and Assembly with Qualities

See also

Sequencing quality and standards:

Sequencing projects

File formats

Sequence Alignment/Map (SAM) format: "A generic format for storing large nucleotide sequence alignments". Tab-delimited text format consisting of a header section (optional) and an alignment section.

See also

Binary Compressed Sam format/Binary Alignment Format (BAM): Binary, compressed file format containing the same information as SAM files.

From : "Centers align sequence reads to a reference genome to produce a Sequence Alignment Map (SAM) format file. The SAM file is then converted into a binary form, or Binary-sequence Alignment Format (BAM) file"

See also

Variant Call Format (VCF):

Standard created by the 1000 Genomes Project.

From :

"The VCF format is a tab delimited format for storing variant calls and and individual genotypes. It is able to store all variant calls from single nucleotide variants to large scale insertions and deletions."

ABI (Applied Biosystems) format:


FASTQ files encode identified nucleotides together with their corresponding quality scores. The interpretation of the quality scores may vary depending on the source of the sequence, but the most used is the "Sanger format" (Phred quality scores).


Comparison of variant-calling software


The state of NGS variant calling - Don't panic:


Personal tools