User:Jarle Pahr/PCR

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 34: Line 34:
For a comparison of various polymerases, see
For a comparison of various polymerases, see
==Phusion polymerase==
===Phusion polymerase===
Note on Phusion polymerase:
Note on Phusion polymerase:
Line 66: Line 66:
===Home-grown polymerase===

Revision as of 14:09, 27 March 2013

^^ Tips on getting one band, by using one band of a first PCR as template for a second PCR:

For low-GC templates, some regions of the amplicon may have a melting temperature lower than the extension temperature, causing denaturation during the extension step and failure of the PCR reaction. (



Polymerase Speed (min/kb) Fidelity Supplier Reference 5'-3' Exonuclease? 3'-5' exonuclease (proof reading) Strand displacement? Overhang? Amplicon size
Taq 1 Example ex Yes No Yes 3'-A
Phusion 0.25-0.50 Example NEB No Yes NoNo
Pfu 2 Example Example No Yes No
Q5 ? Example NEB


BiteSize Bio - The best polymerases of 2008:

For a comparison of various polymerases, see

Phusion polymerase

Note on Phusion polymerase:

Quotes from the protocol:

The final concentration of each primer in a reaction using Phusion DNA Polymerase may be 0.2–1 μM, while 0.5 μM is recommended.

During thermocycling, the denaturation step should be kept to a minimum. Typically, a 5–10 second denaturation at 98°C is recommended for most templates.

Annealing: Annealing temperatures required for use with Phusion tend to be higher than with other PCR polymerases. The NEB Tm calculator should be used to determine the annealing temperature when using Phusion. Typically, primers greater than 20 nucleotides in length anneal for 10–30 seconds at 3°C above the Tm of the lower Tm primer. If the primer length is less than 20 nucleotides, an annealing temperature equivalent to the Tm of the lower primer should be used. A temperature gradient can also be used to optimize

[Phusion polymerase]

Finnzyme Tm calculator for use with Phusion:

Strand displacement:


Home-grown polymerase


Sequences for SLIC:

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
rrnB p1_74bp_FWD40 agccgggcgatgccaaccggGTTGCGCGGTCAGAAAATTA For amplification of 74 bp promoter fragments plus SLIC linkers
rrnB p1_74bp_REV39 ctccattattattgtacatgAGTGGTGGCGCATTATAGG  ?
rrnB_p1_long_FWD20agccgggcgatgccaaccggGTATCCTACGCCCGTGGTTA? For amplification of 389 bp fragment plus SLIC linkers. Use together with rrnB p1_74bp_REV
GreA_60bp_FWD agccgggcgatgccaaccggGGCGCAACGCCCTATAAAGT  ?
GreA_long_FWD40agccgggcgatgccaaccggTCACCCTTAAGTACGCCGTT59 50.00For amplification of 399bp fragment plus SLIC linkers.
GreA_60bp_REV45 ctccattattattgtacatgATAGTCATTTTACCCTGAAGTTCCC?

Sequences for amplification from pSB-M1g:

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment
RBS-GFPstart20ATGGAGTCATGAACATATGG56 40For amplification from pSB-M1g, starting from RBS. Somewhat low GC content, and does not pass 5' end stability check in Clone Manager.
pSB-REV120TCAAGGATGTGGATCTGCTG57(2)/64.4(1)/57.3(3) 50For amplification of vector backbone from pSB-M1g. Binds at same site as SeqMG1, between OriT and AgeI. Amplicon includes Colony PCR FWD2 site, but not the Seq5 site.
pSB-REV220CCGGCTTTCTTAGACACTCT60.5(1) 50For amplification of vector backbone from pSB-M1g. Binds at beginning of SLIC linker B. Includes Colony PCR FWD2 and Seq5 sites, but not AgeI. Triggers primer dimer warning in Clone Manager.
GFP-END-LVA-EcoRI-BamHI-REV72agaggatcccttaagttaagctactaaagcgtagttttcgtcgtttgctgcTTTGTATAGTTCATCCATGCC Primer for amplification of end region of GFP from pSB-M1g with addition of LVA-tag plus EcoRI (italic) and BamHI (bold) sites.

Sequences for restriction-ligation cloning (RL cloning):

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment

Sequences for Ligation-independent cloning (LIC):

Name Length (bp) Sequence Tm (C) [calculated] Tm (C) [Analytical] GC (% / bp) Comment

For SacII-based LIC sequence, see

Tm notes:

  • 1: Finnzyme/Thermo Scientific Tm Calculator
  • 2: Clone Manager
  • 3: Primer 3

BioBrick sequences:


Average molecular weight: 487 g/mol

Oligomer annealing

PCR techniques

"sticky end PCR method": Can be used to generate PCR products with restriction site-compatible overhang. Can be used to clone fragments which contain the same restriction site(s) as the vector.

Colony PCR

Emulsion PCR

Touchdown PCR


Primer Design

Optimization and troubleshooting

Personal tools