User:Jakob G. Wells

From OpenWetWare

Revision as of 15:32, 8 November 2012 by Jakob G. Wells (Talk | contribs)
Jump to: navigation, search

Contents

Contact Info

Jakob G. Wells (an artistic interpretation)
Jakob G. Wells (an artistic interpretation)
  • Jakob G. Wells
  • Arizona State University
  • 500 East University Drive
  • Tempe, Arizona, United States
  • Email me

I work in the Your Lab at XYZ University. I learned about OpenWetWare from via email, and I've joined because Requirement for class.

Education

  • Currently seeking a Bachelors in Science and Engineering at Arizona State University

Research interests

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.

Screen_Shot_2012-11-01_at_3.56.31_PM.png

Source: http://openpcr.org/use-it/

  1. Interest 2
  2. Interest 3

Publications

  1. Goldbeter A and Koshland DE Jr. . pmid:6947258. PubMed HubMed [Paper1]
  2. JACOB F and MONOD J. . pmid:13718526. PubMed HubMed [Paper2]
    leave a comment about a paper here

  3. Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. isbn:0879697164. [Book1]
All Medline abstracts: PubMed HubMed

Useful links

Personal tools