User:Jakob G. Wells
From OpenWetWare
(Difference between revisions)
Current revision (16:36, 15 November 2012) (view source) (→Education) |
|||
| Line 12: | Line 12: | ||
==Education== | ==Education== | ||
<!--Include info about your educational background--> | <!--Include info about your educational background--> | ||
| - | * Currently seeking a Bachelors in Science and Engineering at Arizona State University | + | * Currently seeking a Bachelors in Science and Engineering in Biomedical Engineering at Arizona State University |
==Research interests== | ==Research interests== | ||
Current revision
Contents |
Contact Info
- Jakob G. Wells
- Arizona State University
- 500 East University Drive
- Tempe, Arizona, United States
- Email me
I work in the geotechnical lab at Speedie and Associates.
Education
- Currently seeking a Bachelors in Science and Engineering in Biomedical Engineering at Arizona State University
Research interests
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.
Source: http://openpcr.org/use-it/
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. . pmid:6947258.
- JACOB F and MONOD J. . pmid:13718526.
leave a comment about a paper here - Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. isbn:0879697164.
