User:Jakob G. Wells: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(14 intermediate revisions by 2 users not shown)
Line 1: Line 1:
==Contact Info==
==Contact Info==
[[[IMG]http://i.imgur.com/1OlpC.jpg[/IMG]Jakob G. Wells]]
[[Image:XZEGG.jpg|thumb|right|Jakob G. Wells]]  


*Jakob G. Wells
*Jakob G. Wells
Line 8: Line 8:
*[[Special:Emailuser/Jakob G. Wells|Email me]]
*[[Special:Emailuser/Jakob G. Wells|Email me]]


I work in the [[Your Lab]] at XYZ University.  I learned about [[OpenWetWare]] from via email, and I've joined because Requirement for class.
I work in the geotechnical lab at Speedie and Associates.


==Education==
==Education==
<!--Include info about your educational background-->
<!--Include info about your educational background-->
* Currently seeking a Bachelors in Science and Engineering at Arizona State University
* Currently seeking a Bachelors in Science and Engineering in Biomedical Engineering at Arizona State University


==Research interests==
==Research interests==
<!-- Feel free to add brief descriptions to your research interests as well -->
<!-- Feel free to add brief descriptions to your research interests as well -->
# Curing cancer
==Research and Development==
# Solving world hunger
 
# Find world peace
'''Specific Cancer Marker Detection - The Underlying Technology'''<br>
 
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA.  Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands.  The PCR then heats to 72°C so the DNA strand can be re-written.  The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”.  If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.<br>
 
http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png
 
Source: http://openpcr.org/use-it/
# Interest 2
# Interest 3


==Publications==
==Publications==

Latest revision as of 13:36, 15 November 2012

Contact Info

Jakob G. Wells
  • Jakob G. Wells
  • Arizona State University
  • 500 East University Drive
  • Tempe, Arizona, United States
  • Email me

I work in the geotechnical lab at Speedie and Associates.

Education

  • Currently seeking a Bachelors in Science and Engineering in Biomedical Engineering at Arizona State University

Research interests

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.

http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png

Source: http://openpcr.org/use-it/

  1. Interest 2
  2. Interest 3

Publications

  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 | PubMed ID:6947258 | HubMed [Paper1]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 | PubMed ID:13718526 | HubMed [Paper2]

    leave a comment about a paper here

  3. ISBN:0879697164 [Book1]

All Medline abstracts: PubMed | HubMed

Useful links