User:Jakob G. Wells
From OpenWetWare
(Difference between revisions)
(→Research interests) |
Current revision (16:36, 15 November 2012) (view source) (→Education) |
||
| (14 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
==Contact Info== | ==Contact Info== | ||
| - | [[ | + | [[Image:XZEGG.jpg|thumb|right|Jakob G. Wells]] |
*Jakob G. Wells | *Jakob G. Wells | ||
| Line 8: | Line 8: | ||
*[[Special:Emailuser/Jakob G. Wells|Email me]] | *[[Special:Emailuser/Jakob G. Wells|Email me]] | ||
| - | I work in the | + | I work in the geotechnical lab at Speedie and Associates. |
==Education== | ==Education== | ||
<!--Include info about your educational background--> | <!--Include info about your educational background--> | ||
| - | * Currently seeking a Bachelors in Science and Engineering at Arizona State University | + | * Currently seeking a Bachelors in Science and Engineering in Biomedical Engineering at Arizona State University |
==Research interests== | ==Research interests== | ||
<!-- Feel free to add brief descriptions to your research interests as well --> | <!-- Feel free to add brief descriptions to your research interests as well --> | ||
| - | + | ==Research and Development== | |
| - | # | + | |
| - | # | + | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> |
| + | |||
| + | PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.<br> | ||
| + | |||
| + | http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png | ||
| + | |||
| + | Source: http://openpcr.org/use-it/ | ||
| + | # Interest 2 | ||
| + | # Interest 3 | ||
==Publications== | ==Publications== | ||
Current revision
Contents |
Contact Info
- Jakob G. Wells
- Arizona State University
- 500 East University Drive
- Tempe, Arizona, United States
- Email me
I work in the geotechnical lab at Speedie and Associates.
Education
- Currently seeking a Bachelors in Science and Engineering in Biomedical Engineering at Arizona State University
Research interests
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.
Source: http://openpcr.org/use-it/
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. . pmid:6947258.
- JACOB F and MONOD J. . pmid:13718526.
leave a comment about a paper here - Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. isbn:0879697164.


