User:Jakob G. Wells
From OpenWetWare
(Difference between revisions)
| Line 8: | Line 8: | ||
*[[Special:Emailuser/Jakob G. Wells|Email me]] | *[[Special:Emailuser/Jakob G. Wells|Email me]] | ||
| - | I work in the | + | I work in the Speedie and Associates lab at Speedie and Associates. |
==Education== | ==Education== | ||
Revision as of 17:07, 8 November 2012
Contents |
Contact Info
- Jakob G. Wells
- Arizona State University
- 500 East University Drive
- Tempe, Arizona, United States
- Email me
I work in the Speedie and Associates lab at Speedie and Associates.
Education
- Currently seeking a Bachelors in Science and Engineering at Arizona State University
Research interests
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.
Source: http://openpcr.org/use-it/
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. . pmid:6947258.
- JACOB F and MONOD J. . pmid:13718526.
leave a comment about a paper here - Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. isbn:0879697164.
