User:Jakob G. Wells

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==Contact Info==
==Contact Info==
[[Image:OWWEmblem.png|thumb|right|Jakob G. Wells (an artistic interpretation)]]  
[[Image:XZEGG.jpg|thumb|right|Jakob G. Wells]]  
*Jakob G. Wells
*Jakob G. Wells

Revision as of 16:40, 8 November 2012


Contact Info

Jakob G. Wells
Jakob G. Wells
  • Jakob G. Wells
  • Arizona State University
  • 500 East University Drive
  • Tempe, Arizona, United States
  • Email me

I work in the Your Lab at XYZ University. I learned about OpenWetWare from via email, and I've joined because Requirement for class.


  • Currently seeking a Bachelors in Science and Engineering at Arizona State University

Research interests

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.



  1. Interest 2
  2. Interest 3


  1. Goldbeter A and Koshland DE Jr. . pmid:6947258. PubMed HubMed [Paper1]
  2. JACOB F and MONOD J. . pmid:13718526. PubMed HubMed [Paper2]
    leave a comment about a paper here

  3. isbn:0879697164. [Book1]
All Medline abstracts: PubMed HubMed

Useful links

Personal tools