User:Esther Lee/Notebook/DNA Sequencing/Entry Base: Difference between revisions
From OpenWetWare
Esther Lee (talk | contribs) (Autocreated Lab Notebook name=User:Esther Lee/Notebook/DNA Sequencing/Entry Base, content from MediaWiki:EntryContentDefault) |
(fix raw html notebook nav) |
||
| (One intermediate revision by one other user not shown) | |||
| Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
'''DNA SEQUENCING''' | |||
''Objective'': To identify through DNA sequencing, the microorganism in found in the transects. | |||
Result of gel electrophoresis | |||
[[Image:OOW 10.jpg]] | |||
We were not able to get valid results for DNA sequencing for our transect. However, we were able to observe Transect 3: Tall Grass because of the similarities of two transects. | |||
The DNA Sequence was: | |||
AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGG | |||
GGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT | |||
Using NCBI BLAST, we identified the specie as Chryseobacterium and can be assumed that this particular bacteria is found in both tall grass and wildlife transects. | |||
Latest revision as of 00:07, 27 September 2017
 Project name
|
 Main project page |
|
DNA SEQUENCING Objective: To identify through DNA sequencing, the microorganism in found in the transects. Result of gel electrophoresis
Using NCBI BLAST, we identified the specie as Chryseobacterium and can be assumed that this particular bacteria is found in both tall grass and wildlife transects.
| |
