User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/10/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 29: Line 29:
|}
|}


=Continuation of Restriction Digests and Gel Electrophoresis=
=OTHER: Plasmid Verification of PcTFs=
Restriction Digest Table<br>
Restriction Digest Table<br>
* Checked plasmid minipreps with EcoRI/PstI digests
* Checked plasmid minipreps with EcoRI/PstI digests
Line 45: Line 45:
| bgcolor=#cfcfcf | Reagent  
| bgcolor=#cfcfcf | Reagent  
| bgcolor=#cfcfcf | Volume
| bgcolor=#cfcfcf | Volume
| rowspan="7" | <u>Expected:</u><br>1. fshPCD = 186 bp, 4968 bp<br>
| rowspan="7" | <u>Expected:</u><br>1. hPCD = 1921 bp, 4592 bp<br>
| rowspan="7" | [[Image:Gel DKB 10-3-13.jpg|400px|Today's gel]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder]
| rowspan="7" | [[Image:Gel DKB 10-3-13.jpg|400px|Today's gel]]<br>15 μL/lane; 1% agarose; [http://openwetware.org/wiki/Image:KAH_Fermentas_GeneRuler_1kbplus.jpg Ladder]
|-
|-

Revision as of 14:41, 27 October 2014

Cell Fate Switch by Synthetic Transcription Factors <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

New Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
INS1 NM_008386.3 cagagaggaggtactttggactataaa gccatgttgaaacaatgacct 105, cat.no. 04692241001
NKX6-1 NM_144955.2 cccggagtgatgcagagt gaacgtgggtctggtgtgtt 103, cat.no. 04692217001
MNX1 NM_019944.2 gatgccggacttcagctc agctgctggctggtgaag 60, cat.no. 04688589001
SLC30A8 NM_172816.3 gctgcttcagcaatatgcttc cagactcccagcaacgtgt 53, cat.no. 04688503001
KLF9 NM_010638.4 ctcagaactgcttttaacattaggg aacactttcctttttagctcgtg 32, cat.no. 04687655001
PCSK2 NM_008792.4 ggcgtgtttgcattagcttt gcacagtcagatgttgcatgt 85, cat.no. 04689097001

OTHER: Plasmid Verification of PcTFs

Restriction Digest Table

  • Checked plasmid minipreps with EcoRI/PstI digests
Reagent Volume Expected:
1. hPCD = 1921 bp, 4592 bp
 Today's gel
15 μL/lane; 1% agarose; Ladder
DNA(plasmid) 5.0 μL
10X FD Buffer 1.5
EcoRI 1.0
PstI 1.0
dH2O 6.5
  15 μL --> 37°C/ 15 min.

Conclusion All bands at ~4900 and ~2000; indicating MV2 vector and PcTF insert, respectively.



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:David_K._Barclay/Notebook/Controlling_Pancreas_Cell_Fate_Using_Transcription_Factors/2014/10/27&oldid=838111"