User:Corey Bear/Notebook/(22 July 2014) DNA Sequence of Transect
Intent: The intent of this experiment was to learn and understand the diversity of complexity of DNA structures found within the transect.
Overview: This experiment involved two major sub-processes that solidified the circle of life present in the American University Farm transect site. The first process was to visit a DNA website that helped depict and identified processed DNA—link below— further enabling a genetic analysis of the transect. While analysis was capable through broad online resources, the actual DNA data obtained from the transact was corrupted during the PCR. Information regarding the DNA structures found in the transect, which can be found in the Observation section of this report, are derived from previous student would were capable of completing the PCR without error. The second process to this experiment was to search, analysis, and report on finding from previous student regarding DNA found in the transept site.
‘’’Observations:’’’ The DNA sequence that was analyzed in support of the farm transect was derived other sources that had previously conducted a 16S DNA PCR. The sequence, which can be found below, is 206 characters long. (Morgulis, et al, 2014) This sequence is found in over over 100 different species, ranging from Chryseobacterium Shigense sp. to
Website for DNA BLAST: http://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_385866652
DNA Sequence provided:
AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGGGGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT
(Bentley, et al, 2014).
Reference
Bentley., Walters-Conte., & Zeller. (2014). Biology 210 Lab Manual. Washington: American University.
Morgulis A, Coulouris G, Yan Raytselis, Madden T,Agarwala R, and Schäffer A. [2008]. Database Indexing for Production MegaBLAST Searches. Bioinformatics 24:1757-1764. Available from http://blast.ncbi.nlm.nih.gov/Blast.cgi