User:Corey Bear/Notebook/(22 July 2014) DNA Sequence of Transect: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreated Lab Notebook name=User:Corey Bear/Notebook/(22 July 2014) DNA Sequence of Transect, content from MediaWiki:ProjectContentDefault)
 
No edit summary
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
{|{{table}} width="800"
'''Intent:''' The intent of this experiment was to learn and understand the diversity and complexity of DNA structures found within the transect.  
|-
|style="background-color: #cdde95;" align="center"|
<!-- ## START calendar column -->
<LNCalendar></LNCalendar>
<!-- ## END calendar column -->
|align="center" style="background-color: #e5edc8;" |
<!-- ## START search column: Place your logo here. Try keep it below 200px in width and 150px in height. ##  -->
[[Image:owwnotebook_icon.png|128px]] <sitesearch>title=Search this Project</sitesearch>
<!-- ## END search column  ## -->
|-
|colspan="2" style="background-color: #F2F2F2;" align="right"|[[{{FULLPAGENAME}}/Entry_Base|Customize your entry pages]] [[Help:Notebook/Project_Base/Customize_entry_page|<html><img src="/images/a/aa/Help.png" border="0" /></html>]]
|-
|colspan="2"|
==Project Description/Abstract==
* Place short description of project or notes regarding this project


* Lorem ipsum dolor sit amet, consectetuer adipiscing elit. Donec porta commodo tellus. Nam a est eget libero mollis tincidunt. Aliquam purus. Quisque nulla ligula, facilisis in, pulvinar sed, molestie a, quam. Vestibulum at pede. In in sem eget odio eleifend placerat. Phasellus ultricies felis quis sapien. Etiam molestie volutpat quam. Praesent pulvinar scelerisque mi. Nam mi urna, fringilla eu, mattis sed, venenatis id, nunc. Maecenas velit eros, congue ut, placerat in, ornare vel, sem. Aenean porta enim sit amet felis gravida posuere. Phasellus faucibus nibh et orci.
'''Overview:'''  This experiment involved two major sub-processes that solidified the circle of life present in the American University Farm transect site. The first process was to visit a DNA website that helped depict and identified processed DNA—link below— further enabling a genetic analysis of the transect. While analysis was capable through broad online resources, the actual DNA data obtained from the transact was corrupted during the PCR. Information regarding the DNA structures found in the transect, which can be found in the Observation section of this report, are derived from previous student would were capable of  completing the PCR without error. The second process to this experiment was to search, analyze, and report on findings found within previous students’ Openwetware regarding DNA from the same transept site.


==Notes==
'''Observations:'''  The DNA sequence that was analyzed in support of the farm transect was derived from other sources that had previously conducted a 16S DNA PCR. The sequence, which can be found below, is a 206 character long code. (Morgulis, et al, 2014) This sequence is found in over 1000 different organisms, ranging from Chryseobacterium Shigense sp.,  Flavobacteriaceae, and Chryseobacterium. This DNA is mainly found in bacteria matter, and is most likely prevalent throughout the transect site.  Chryseobacterium Shigense sp, which is the specific DNA that has been BLASTED, is a yellow-pigmented, aerobic bacterium, which was isolated from lactic acid. It is aerobic in nature and acts as a chemo-organotrophic. Data before this point is inconclusive, and therefore the comparison of DNA sequences is limited. It is predicted though, that these bacteria are present throughout the transect, as they provide aerobic and chemo-organotrophic support to other organisms. Moreover, these DNA sequences are most likely stable, as they are present in one of the three domains of life, bacteria. (Bentley, et al, 2014) 
* Place some notes here for visitors


* Example: This project is currently on hold until further notice.
This phylogenetic tree illustrates the sequence connections found from within the transact, to other bacterium and organisms seen throughout the world. (Morgulis, et al, 2014)


[[Image:Bactrium.png]]


|-
|colspan="2" style="background-color: #F2F2F2;"|
{{LnNotebookRecentChanges2}}
|}


__NOTOC__
‘''Website for DNA BLAST:''' http://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_385866652
 
 
'''DNA Sequence provided:'''
 
''AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGGGGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT
''
 
 
 
'''Reference'''
 
Bentley., Walters-Conte., & Zeller. (2014). Biology 210 Lab Manual. Washington: American University.
 
Morgulis A, Coulouris G, Yan Raytselis, Madden T,Agarwala R,  and Schäffer A. [2008]. Database Indexing for Production MegaBLAST Searches. Bioinformatics 24:1757-1764. Available from http://blast.ncbi.nlm.nih.gov/Blast.cgi

Latest revision as of 14:58, 23 July 2014

Intent: The intent of this experiment was to learn and understand the diversity and complexity of DNA structures found within the transect.

Overview: This experiment involved two major sub-processes that solidified the circle of life present in the American University Farm transect site. The first process was to visit a DNA website that helped depict and identified processed DNA—link below— further enabling a genetic analysis of the transect. While analysis was capable through broad online resources, the actual DNA data obtained from the transact was corrupted during the PCR. Information regarding the DNA structures found in the transect, which can be found in the Observation section of this report, are derived from previous student would were capable of completing the PCR without error. The second process to this experiment was to search, analyze, and report on findings found within previous students’ Openwetware regarding DNA from the same transept site.

Observations: The DNA sequence that was analyzed in support of the farm transect was derived from other sources that had previously conducted a 16S DNA PCR. The sequence, which can be found below, is a 206 character long code. (Morgulis, et al, 2014) This sequence is found in over 1000 different organisms, ranging from Chryseobacterium Shigense sp., Flavobacteriaceae, and Chryseobacterium. This DNA is mainly found in bacteria matter, and is most likely prevalent throughout the transect site. Chryseobacterium Shigense sp, which is the specific DNA that has been BLASTED, is a yellow-pigmented, aerobic bacterium, which was isolated from lactic acid. It is aerobic in nature and acts as a chemo-organotrophic. Data before this point is inconclusive, and therefore the comparison of DNA sequences is limited. It is predicted though, that these bacteria are present throughout the transect, as they provide aerobic and chemo-organotrophic support to other organisms. Moreover, these DNA sequences are most likely stable, as they are present in one of the three domains of life, bacteria. (Bentley, et al, 2014)

This phylogenetic tree illustrates the sequence connections found from within the transact, to other bacterium and organisms seen throughout the world. (Morgulis, et al, 2014)


Website for DNA BLAST:' http://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_385866652


DNA Sequence provided:

AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGGGGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT


Reference

Bentley., Walters-Conte., & Zeller. (2014). Biology 210 Lab Manual. Washington: American University.

Morgulis A, Coulouris G, Yan Raytselis, Madden T,Agarwala R, and Schäffer A. [2008]. Database Indexing for Production MegaBLAST Searches. Bioinformatics 24:1757-1764. Available from http://blast.ncbi.nlm.nih.gov/Blast.cgi