User:Brady P. Dennison/Notebook/Notebook/2015/10/27

From OpenWetWare
Jump to navigationJump to search
Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Oligo Primer Creation for Sequencing

Sequence Required for Reverse Primer of mCherry:
F primer for the KAH60/pcVN ggtcaaagacagttgactgtatcgc

Used the Website: https://www.idtdna.com/site
Total Cost:
$9.25

Used the Following Concentrations for Sequencing:
1 μL of DNA (208 ng/μL Concentration
1 μL of Forward Primer
8 μL of Water

Took Tube to be sequenced to DNA ASU


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Brady_P._Dennison/Notebook/Notebook/2015/10/27&oldid=918533"