User:Bill Flanagan
My name is Bill Flanagan.
I'm the Senior Technology Developer for OpenWetWare.
I work for MIT in the Department of Biological Engineering.
My background is in building online systems to facilitate collaboration.
Contact
- For OWW logged-in members: Click Here
- Email: bill at openwetware dot org
Links
Google Docs
<GoogleDocs />
Adobe Advanced Annotations (A3)
Adobe Advanced Annotations (A3)
Erik Wilde (mailto:pdf@dret.net)
Computer Engineering and Networks Laboratory (TIK)
Swiss Federal Institute of Technology (ETH Zurich)
ETH-Zentrum, 8092 Zurich, Switzerland
May 2002
Abstract
PDF in its current for has rather weak support for annotations. This paper describes a usage scenario and how advanced annotations support could make using PDF (and possibly other Adobe applications) more productive. Starting from these observations, different problems are described which could be solved based on different evolutionary steps of the annotation architecture, which has been dubbed “Adobe Advanced Annotations (A3 )”. Following this scenario, some design approaches and a number of implementation issues are discussed.
<showpdf>http://dret.net/netdret/docs/wilde-a3.pdf</showpdf>
DAS
ftp://selab.janelia.org/pub/publications/Dowell01/Dowell01-preprint.pdf
The Distributed Annotation System
Robin D. Dowell1 , Rodney M. Jokerst1 , Allen Day2 , Sean R. Eddy1 , and Lincoln Stein2 ∗
{robin,jokerst,eddy}@genetics.wustl.edu
Howard Hughes Medical Institute
Department of Genetics,
Washington University, St. Louis, MO 63110 USA
{day,lstein}@cshl.org
Cold Spring Harbor Laboratory,
1 Bungtown Road, Cold Spring Harbor, NY 11724 USA
Abstract
Background
Currently, most genome annotation is curated by centralized groups with limited resources. Efforts to share annotations transparently among multiple groups have not yet been satisfactory.
Results
Here we introduce a concept called the Distributed Annotation System (DAS). DAS allows sequence annotations to be decentralized among multiple third-party annotators and integrated on an as-needed basis by client-side software. The communication between client and servers in DAS is defined by the DAS XML specification. Annotations are displayed in layers, one per server. Any client or server adhering to the DAS XML specification can participate in the system; we describe a simple prototype client and server example.
Conclusions
The DAS specification is being used experimentally by Ensembl, WormBase, and the Berkeley Drosophila Genome Project. Continued success will depend on the readiness of the research community to adopt DAS and provide annotations. All components are freely available from the project website http://www.biodas.org/.
Annotation
Notification for Shared Annotation of Digital Documents
A.J. Bernheim Brush, David Bargeron, Anoop Gupta and Jonathan Grudin
September 19, 2001
Technical Report
MSR-TR-2001-87
Microsoft Research
Microsoft Corporation
One Microsoft Way
Redmond, WA 98052
Notification and shared annotation go hand-in-hand. It is widely recognized that notification of activity in a shared document annotation system helps support awareness and improve asynchronous collaboration. But few studies have examined user needs, and there has been little exploration of design tradeoffs. We examined the large-scale use of notifications in a commercial system, and found it lacking. We designed and deployed enhancements to the system, and then conducted a field study to gauge their effect. We found that providing more information in notification messages, supporting multiple communication channels through which notifications could be received, and allowing customization of notification messages were particularly important. Overall awareness of annotation activity on specs increased with our enhancements.
<showpdf>http://research.microsoft.com/pubs/69880/tr-2001-87.pdf</showpdf>
Online Protocol Annotation
Essay
Online Protocol Annotation: A Method to Enhance Undergraduate Laboratory Research Skills
Julie E. Ruble and Barbara Lom
Biology Department and Neuroscience Program, Davidson College, Davidson, NC
Submitted February 22, 2008; Accepted April 14, 2008
Monitoring Editor: Paul Williams
A well-constructed, step-by-step protocol is a critical starting point for teaching undergraduates new techniques, an important record of a lab’s standard procedures, and a useful mechanism for sharing techniques between labs. Many research labs use websites to archive and share their protocols for these purposes. Here we describe our experiences developing and using a protocol website for the additional purpose of enhancing undergraduate research training. We created our lab’s protocol website in a message board format that allows undergraduates to post comments on protocols describing the lessons they learned, questions that arose, and/or insights they gained while learning to execute specific research protocols. Encouraging and expecting students to comment on the protocols they are learning to execute is beneficial for both the student and for the lab in which they are training. For the student, annotations encourage active reflection on their execution of techniques and emphasize the important message that attending to and understanding details of a protocol is a critical factor in producing reliable data. For the lab, annotations capture valuable insights for future generations of researchers by describing missing details, hints, and common hurdles for newcomers.
CBE—Life Sciences Education Vol. 7, 296 –301, Fall 2008
<showpdf>http://www.lifescied.org/cgi/reprint/7/3/296.pdf</showpdf>
One Big Lab
A group of students in my human-computer interaction class a few years ago developed an idea called Collaboread for their final project. In essence, it allowed multiple online users to markup a document, enabling collaborative annotation. I'm sure there are several products out there that allow either online markup of documents (Adobe, for one) or collaborative editing (Google Docs), but I haven't seen anything that resembles exactly what I envision.
Neo Note
Suggestions for a Global Shared Scholarly Annotation System
D-Lib Magazine
May/June 2009
Volume 15 Number 5/6
ISSN 1082-9873
NeoNote
Suggestions for a Global Shared Scholarly Annotation System
Bradley Hemminger, Ph.D.
Associate Professor
School of Information and Library Science
University of North Carolina, Chapel Hill
<bmh@ils.unc.edu>
Abstract
There is a need for integrated support for annotation and sharing within the primary tool used for interacting with the World Wide Web, which today is a web browser. Based on prior work and user studies in our research lab, we1 propose design recommendations for a global shared annotation system, for the domain of scholarly research. We describe a system built using these design recommendations (NeoNote), and provide an example video demonstrating the suggested features. Finally, we discuss the major challenges that remain for implementing a global annotation system for sharing scholarly knowledge.
PDF Annotation
Free means to annotate (comment) a PDF?
Posted Dec 2, 2004 19:02 UTC (Thu) by d.e.cox (guest, #3912)
Parent article: The Grumpy Editor's Guide to PDF Viewers
I haven't found a free means to annotate (add little yellow comment boxes) to PDFs. I've used this feature of Adobe's products quite a bit, and it looks to be one of the major improvements in acrobat 7. Anyone know if this kind of capability is in the pipeline of the free readers xpdf, ggv, etc?
Wired
The End of Theory: The Data Deluge Makes the Scientific Method Obsolete
WIRED MAGAZINE: 16.07 Science: Discoveries RSS The End of Theory: The Data Deluge Makes the Scientific Method Obsolete By Chris Anderson Email 06.23.08
"Speaking at the O'Reilly Emerging Technology Conference this past March, Peter Norvig, Google's research director, offered an update to George Box's maxim: "All models are wrong, and increasingly you can succeed without them."
...
"In February, the National Science Foundation announced the Cluster Exploratory, a program that funds research designed to run on a large-scale distributed computing platform developed by Google and IBM in conjunction with six pilot universities."
Information seeking behavior of academic scientists
Research Article
Information seeking behavior of academic scientists
Bradley M. Hemminger 1, Dihui Lu 2, K.T.L. Vaughan 3, Stephanie J. Adams 4
206A Manning Hall, SILS, School of Information and Library Science, University of North Carolina at Chapel Hill, NC. 27599-3360
School of Information and Library Science, University of North Carolina at Chapel Hill
Health Sciences Library, University of North Carolina at Chapel Hill
School of Information and Library Science, University of North Carolina at Chapel Hill
email: Bradley M. Hemminger (bmh@ils.unc.edu)
Index Terms
information seeking • scholars • information resources • electronic publications • online databases
Abstract
The information seeking behavior of academic scientists is being transformed by the availability of electronic resources for searching, retrieving, and reading scholarly materials. A census survey was conducted of academic science researchers at the University of North Carolina at Chapel Hill to capture their current information seeking behavior. Nine hundred two subjects (26%) completed responses to a 15-minute Web-based survey. The survey questions were designed to quantify the transition to electronic communications and how this affects different aspects of information seeking. Significant changes in information seeking behavior were found, including increased reliance on web based resources, fewer visits to the library, and almost entirely electronic communication of information. The results can guide libraries and other information service organizations as they adapt to meet the needs of today's information searchers. Simple descriptive statistics are reported for the individual questions. Additionally, analysis of results is broken out by basic science and medical science departments. The survey tool and protocol used in this study have been adopted for use in a nationwide survey of the information seeking behavior of academic scientists. Received: 14 July 2006; Revised: 14 February 2007; Accepted: 15 February 2007
doi: 10.1002/asi.20686
Biomedical Searching
Hemminger BM, Saelim B, Sullivan PF, Vision TJ, "Comparison of full-text searching to metadata searching for genes in two biomedical literature cohorts", JASIST, 58:14:2341-2352, 2007. <http://dx.doi.org/10.1002/asi.20708>.
doi: 10.1002/asi.20708
Wiki1001
Site URL: http://www.wiki1001.com |
OWW Page: http://www.wiki1001.com/wiki/25 |
Wiki1001.com tracks Internet Wikis. OpenWetWare.org was added recently to it. Take a look at the site. Feel free to say something about OWW (great, good, or otherwise!)
BioBricks
BBa J22001
PMID 123456
>BBa_J22001 Part-only sequence (2630 bp)
<dnaseq>
aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagtactagatgattaaccgtatccgc
gtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagct
ttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgcgcattaacctgagtcgttcagcggtacg
gatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaa
ttcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgatt
acctagattatggcaatactggagcttatttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtga
aaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctg
gtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctga
ccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatgcaacgctctttgactgacaccgtcactcatgtccgcgaaggttcaga
tgccatctatgccggtacccgtgaaattgcggcgggcaacaccgatctttcctcccgtactgaacagcaggcatccgcgctggaagaaactgccgccagc
atggagcagctcaccgcgacagtgaagcaaaacgccgataacgcccgccaggcctcgcaactggcgcaaagtgcctccgacaccgcccagcacggcggca
aagtggtggatggcgtagtgaaaacgatgcatgagatcgccgatagttcgaagaaaattgccgacattatcagcgttatcgacggtattgccttccagac
taatatcctcgcgctgaatgccgcggttgaagccgcgcgtgcgggtgaacagggccgtggttttgccgtggtggcgggtgaagtgcgtaatcttgccagt
cgcagcgcccaggcggcaaaagagatcaaagccctcattgaagactccgtctcacgcgttgataccggttcggtgctggtcgaaagcgccggggaaacaa
tgaacaatatcgtcaatgctgtcactcgcgtgactgacattatgggcgagattgcatcggcatcggatgaacagagccgtggcatcgatcaagtcgcatt
ggcggtttcggaaatggatcgcgtcacgcaacagaacgcatcgctggtgcaggaatcagctgccgccgccgctgcgctggaagaacaggcgagtcgttta
acgcaagcagtttccgcgttccgtctggcagccagcccactcaccaataaaccgcaaacaccatcccgtcctgccagtgagcaaccaccggctcagccac
gactgcgaattgctgaacaagatccaaactgggaaacattttgatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcacc
ggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctga
ccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccga
ccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgc
gccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt
acaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgt
gcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa
gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactaga
gccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct
caccttcgggtgggcctttctgcgtttata
</dnaseq>
Barcodes
References
Examples
Absolute pagename: Generate a simple barcode
<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=http://openwetware.org/wiki/User:Bill Flanagan&choe=UTF-8' /> </html>
<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=User:Bill Flanagan&choe=UTF-8' /> </html>
Use OWW FULLPAGENAME to generate the pagename:
Size: 100x100
<html> <img src='http://chart.apis.google.com/chart?chs=100x100&cht=qr&chl=http://openwetware.org/wiki/</html>User:Bill Flanagan<html>&choe=UTF-8' /> </html>
Neural Networks
References
Prediction of the response under impact of steel armours using a multilayer perceptron
Impact Time and Point Predicted Using a Neural Extended Kalman Filter
Ballistic Performance Evaluation of Multi-layered Armors using Neural Network Algorithm
Underground blast induced ground shock and its modelling using artificial neural network
User:Bill Flanagan/docs/Multi-touch screens and neural networks
Error Backpropagation Neural Calibration and Kalman Filter Position Estimation for Touch Panels
Terms
[neural extended]
[Kalman filter]
[multilayered perceptron]
[artificial neural network]
[Rankine-Hugoniot]
AI
BioJava
Link: BioJava
BioJava is dedicated to providing a Java framework for processing biological data. It include objects for manipulating biological sequences, file parsers, DAS client and server support, access to BioSQL and Ensembl databases, tools for making sequence analysis GUIs and powerful analysis and statistical routines including a dynamic programming toolkit.
BioJava is used in several real-world bioinformatics applications and has been used for bioinformatics analysis in a number of published studies.
Bitnami
Link: Bitnami
MediaWiki Extension Matrix
Link: Mediawiki Extension Matrix
PHP Tube: PHP Upload class for YouTube
Link: [1]
MediaWiki: Magic Words
Link: Magic Words
DNASis SmartNote
MiraiBio has introduced a free lab notebook on their site free for all users.
You can check it out here.
It's well worth a look.
SmartNote is a bona-fide Web 2.0 application. It relies heavily on Javascript using the Dojo.js Javascript library for much of its interaction. It has many "snap-in" tools for doing analysis of DNA sequences. One of the nice features it has is a genome annotation tool. I'm particularly interested in people's reactions to this particular feature. This is their contact information:
MiraiBio (a Hitachi subsidiary) 601 Gateway Blvd. Suite 100 South San Francisco, CA 94080 800-624-6176 www.miraibio.com
Intro Books on Bioinformatics and PCR
(todo: reformat via biblio/cite with isbn numbers, etc)
From: Aaron Hicks
From: Felix:
From: Michael Vieths
Other:
Quasi-Public-Accessible Biology Lab Facilities
(New content: to be moved to appropriate pages when I have time)
Wake Forest: Babcock Demon Incubator
North Carolina
Website: wfubdi.org/bioscience.php
The incubator can provide fully equipped shared wet lab space for early stage bioscience companies. The wet lab space is located in the Piedmont Triad Research Park. The facilities include chemistry and tissue hoods, gas, air, materials disposal, internet access, etc. A partial list of equipment in the lab can be found on the facilities page. In addition to the use of the wet lab, incubator clients can use break room facilities and schedule conference rooms as required.
Equipment:
- LCMS, single quad / UPLC system with PDA detector, auto-sampler and column heater
- UPLC system with PDA detector, auto-sampler, column heater and peptide platform
- Alliance HPLC system with UV/Vis detector, degas system and column heater
- GC - 2010, auto injection system
- Nitrogen Generator – 30 L /min
- UPS system – 5.2 KV
- Empower software
- Classic LAC/E32 Server
- Oilless vacuum Pump
North Carolina Community College BioNetwork Pharmaceutical Center (NCCBNC)
http://www.ncbionetwork.org/index.cfm?dir=Pharmaceutical/center.cfm&sec=4
The BioNetwork Pharmaceutical Center operates as a collaborative venture between Forsyth Technical Community College and Guilford Technical Community College to serve all community colleges in the state. The administrative offices of the Pharmaceutical Center are located in the Piedmont Triad Research Park.
The Pharmaceutical Center is a statewide liaison between pharmaceutical manufacturing needs and worker training. The Center provides leadership in general pharmaceutical manufacturing to improve the quality of learning, training and services at all NC community colleges and to recruit students for their programs.
The Center also works with economic development leaders in the state to help recruit new companies to North Carolina.
The Center coordinates funded innovation and equipment facility projects as individual colleges expand and enhance the capacity of NC community colleges to educate and train individuals in the biotechnology industry
Just like the NCCCS, the Pharmaceutical Center has partners in industry, commerce, economic development organizations, secondary education, public and private colleges and universities.
Lab Equipment Categories
- Lab Equipment
- Analytical Instruments
- Autoclaves & Sterilizers
- Centrifuges & Parts
- Centrifuges
- Rotors & Parts
- Other
- Cleaning Equipment
- Evaporators
- Fermenters
- Furnishings & Facilities
- Heating & Cooling
- Burners & Hotplates
- Cryogenics
- Environmental Chambers
- Freezers & Fridges
- Heating Mantles
- Hoods
- Laboratory Furnaces
- Laboratory Ovens
- Temperature Monitoring
- Water Baths & Chillers
- Other
- Incubators
- Lab Lasers & Photonics
- Lab Scales & Balances
- Digital Scales & Balances
- Mechanical & Beam Balances
- Weights & Calibration Sets
- Other
- Microscopes
- Microscope Parts & Accessories
- Microtomes
- Mixers
- Motion Control
- Power Supply
- Pumps
- Recorders & Plotters
- Shakers
- Stirrers
- Others
Recent Biobricks
<xfeeds>http://partsregistry.org/wiki/index.php?title=Special:Recentchanges&feed=rss</xfeeds>
Representative PCR Models
Perkin Elmer GeneAmp 2400 PCR System Thermal Cycler Perkin Elmer GeneAmp 7500 Realtime Perkin Elmer GeneAmp 9600 Perkin Elmer GeneAmp 9700 Perkin-Elmer GeneAmp 1000 Perkin Elmer Prism 7700 Perkin Elmer Cetus 480 DNA Thermal Cycler Mini Horizontal Electrophoresis PCR Agarose Gel System NewGeneAmp 9600 Thermal Cycler Stratagene Thermocycler model SCS-2 Techne TouchGene Gradient 96 Well Thermal Cycler Techne Genius FGEN02TP Thermal Cycler Hybaid TR3 Omnigene Thermal Cycler Sigma-Aldrich Alumaseal 96 film adhesive plates Biometra Trio-Thermoblock TB-1 Thermocycler Ericomp TwinBlock EZ Thermal Cycler THERMOLYNE BARNSTEAD TEMP-TRONICTHERMAL CYCLER ERICOMP EZ SINGLEBLOCK Thermal Cycler ERICOMP EZ POWERBLOCK II Thermal Cycler Hybaid Omnislide System PCR Thermal Cycler Eppendorf Mastercycler 96 Watt GradientThermal Cycler COY Model 50 TempCycler 35-Well Temperature Cycler
Message
Reference section for Dr. Elana Vanderlay still under construction.
Watch this space for exciting developments.
Test Categories