User:Anthony Salvagno/Notebook/Research/2010/12/17/Custom Plasmid for Unzipping/Stretching Construct/BstXI Custom Plasmid Sequence: Difference between revisions
From OpenWetWare
< User:Anthony Salvagno | Notebook | Research | 2010 | 12 | 17 | Custom Plasmid for Unzipping/Stretching Construct
(New page: ==Insert Sequence== '''GCTCTTCCAGCTC'''CTGGAGATACCCGGTGCTAAGGCCGCTTAATTGGTCGTAGCAAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCTACCGCGTTTTAACCGCCAATAGGATTACTTACTAGTCTCTAGGCACGTGTAAGATATATACATCCTGT''...) |
|||
| Line 1: | Line 1: | ||
==Insert Sequence== | ==Insert Sequence== | ||
'''GCTCTTCCAGCTC''' | '''GCTCTTCCAGCTC'''CTGGAGATACCCGGTGCTAAGGCCGCTTAATTGGTCGTAGCAAGCTCTAGCACCGCTTAAACGCACGTACGCGCTG<br>TCTACCGCGTTTTAACCGCCAATAGGATTACTTACTAGTCTCTAGGCACGTGTAAGATATATACATCCTGT'''CCAACGATCTGG'''<br> | ||
In '''bold''': | In '''bold''': | ||
#SapI restriction site compatible with adapter dublex | #SapI restriction site compatible with adapter dublex | ||
#BstXI restriction site compatible with adapter duplex | #BstXI restriction site compatible with adapter duplex | ||
Not in bold is a high-affinity nucleosome binding site adapted from the 601 sequence 147. It is known as 147TA and can be found [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WK7-4C2PXCN-4&_user=1550512&_coverDate=05%2F07%2F2004&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000053660&_version=1&_urlVersion=0&_userid=1550512&md5=b7197090f87687529e7682ddcc04cbab&searchtype=a#secx10 here] from Widom. | Not in bold is a high-affinity nucleosome binding site adapted from the 601 sequence 147. It is known as 147TA and can be found [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WK7-4C2PXCN-4&_user=1550512&_coverDate=05%2F07%2F2004&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000053660&_version=1&_urlVersion=0&_userid=1550512&md5=b7197090f87687529e7682ddcc04cbab&searchtype=a#secx10 here] from Widom. | ||
==Plasmid Sequence== | ==Plasmid Sequence== | ||
Revision as of 11:27, 20 December 2010
Insert Sequence
GCTCTTCCAGCTCCTGGAGATACCCGGTGCTAAGGCCGCTTAATTGGTCGTAGCAAGCTCTAGCACCGCTTAAACGCACGTACGCGCTG
TCTACCGCGTTTTAACCGCCAATAGGATTACTTACTAGTCTCTAGGCACGTGTAAGATATATACATCCTGTCCAACGATCTGG
In bold:
- SapI restriction site compatible with adapter dublex
- BstXI restriction site compatible with adapter duplex
Not in bold is a high-affinity nucleosome binding site adapted from the 601 sequence 147. It is known as 147TA and can be found here from Widom.
