The BioBricks Foundation:Standards/Technical/E.coli promoter standard

Jason R. Kelly 02:11, 30 March 2008 (EDT):We need to make a decision about where to locate transcription start site (+1 site) in BB promoters. There's excellent previous discussion on the topic here.

A proposal

Table with nucleotide frequencies from 168 promoters

• R0040:
• tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac(+1)
• Berkeley Promoter Library:

Previous discussion

JCAnderson: The site: http://parts.mit.edu/registry/index.php/Help:BioBrick_Prefix_and_Suffix under the BioBrick Prefix section has a really critical piece of information on how to design biobrick basic parts, and I think we should add to that a preferred way of biobricking the promoter initiation site relative to the polylinker to avoid heterogeneity 5' to the biobrick junction. Again, it is an arbitrary standard, and the options are (with the transcription start in bold): Define it like r0040(and what iGEM2006 did for the family of constitutive promoters):

...ctACTAGT

Or have it in the biobrick site explicitly, something like:

...ACTAGT

So that nothing has to be re-made, and so that more native promoter sequence can be present in the part I lean towards defining the standard as the r0040-compatible version.

Clearly not all promoters are going to be compatible with this standard. Some promoters have operators that overlap or extend beyond the transcriptional start. When making basic promoter parts, one has to currently make an arbitrary decision as to where to put the 3' end of the promoter. It would be preferrable to have a standard.

• Reshma 11:12, 21 August 2006 (EDT): I agree that we should have a default standard for the promoter-RBS junction. But in looking at the sequence logo for E. coli promoters, I think the typical nucleotides for the -1 and +1 positions are CA. In the absence of any strong reason to go with another scheme, why not go with E. coli promoter consensus? So perhaps something like ...

...caTACTAGAG

i.e. Pretty similar to the R0040-compatible version but with the transcription start site being a defined nucleotide where possible along with the nucleotide before. It might make it a bit more likely that the transcription start site occurs where we think it should occur.

Reference

1. Hawley DK and McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25;11(8):2237-55. DOI:10.1093/nar/11.8.2237 |