Template:SBB12 part sbb1221: Difference between revisions
Daniel Chao (talk | contribs) No edit summary |
Daniel Chao (talk | contribs) |
||
Line 30: | Line 30: | ||
>dc5002 Forward PCR of rbs.Bla | >dc5002 Forward PCR of rbs.Bla | ||
gataatggttgcGGATCTtacgacgggAAGCTTAAATC | gataatggttgcGGATCTtacgacgggAAGCTTAAATC | ||
>G00101 Reverse BamHI for nahR promoter | >G00101 Reverse BamHI for nahR promoter attaccgcctttgagtgagc | ||
Revision as of 16:51, 12 February 2012
Partname: sbb1221 Description: P_R-Bla Genename: P_R, Bla Source: Lambda phage / synthetic
You are going to make a Bla reporter of the P_R promoter from lambda phage. This promoter shuts down when bound to CI protein. Bla confers ampicillin resistance when expressed, and it can also be assayed biochemically. The sequence of the P_R part, which is present in pBjk2741-jtk2801 is:
GATCTtaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcG
You can get the rbs.Bla part from plasmid pBgl00001-Brp0006. What you want to make is a BglBrick part that would result from joining the P_R part with the rbs.Bla part. However, you'll be making the construct by SOEing. In designing your construction file for this, note that the P_R part is really short, and things will go better if you use oligo ca998 as the forward external oligo instead of some annealing region that binds within the part. Ask JCA if that doesn't make sense.
The vector for your final product should be pBgl00001, and you can use plasmid pBgl00001-Bjk2828. Note that this plasmid has a p15A origin of replication, and as such is much lower copy than most other parts you'll work with. As a result, you won't get much material in your minipreps, and you should adjust things accordingly.
Genomic or plasmid DNA with this feature is available
Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.
Construction File for P_R-Bla (sbb1221)
PCR ca998/dc5001 on pBjk2741-jtk2801 (164 bp, A) PCR dc5002/G00101 on pBgl00001-Brp0006 (1094 bp, B) --------------------------------------------------- PCR ca998/G00101 on A+B (1236 bp, pcrpdt) Digest pcrpdt (EcoRI/BamHI, L, pcrdig) Digest pBgl00001-Bjk2828 (EcoRI/BamHI, 1720+898, L, plasdig) Ligate pcrdig and plasdig, product is pBgl00001-sb1221 --------------------------------------------------- >ca998 Forward PCR of P_R promoter gtatcacgaggcagaatttcag >dc5001 Reverse PCR of P_R promoter cgtaAGATCCgcaaccattatcaccgcc >dc5002 Forward PCR of rbs.Bla gataatggttgcGGATCTtacgacgggAAGCTTAAATC >G00101 Reverse BamHI for nahR promoter attaccgcctttgagtgagc