Template:SBB12Project stdt1203

Hyungjun Kim

Welcome to your project page!

I've given you two parts to make.

• Design oligos to make your part
• Write up a proper construction file on the wiki template associated with your part
• Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.

Finally, you should create a notebook on the on the main class page of the wiki

Partname:     sbb1224
Featurename:  DmrB/FKBP
Genename:     dmrB
Source:       synthetic

You will need to synthesize this one using PCA with full E. coli codon usage. What it encodes is the FKBP domain from DmrB protein. The DmrB binding protein binds to a ligand called B/B Homodimerizer (or AP20187). The sequence is available as part of the iDimerize Inducible Homodimer System optimized for mammalian codon usage. You'll use their sequence info at this site to get the peptide sequence, and then synthesize it for use in E. coli.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.

Construction File

PCA1 on dmrb.01.o01-dmrb.01.o14           (pca1)
PCA2 with dmrb.01.o01/dmrb.01.o14 on pca1 (367 bp, pca2)
Digest pca2                               (NheI/BamHI, L, 1224dig)
Digest pBca9525-Bca1834                   (NheI/BamHI, L, vectdig)
Ligate 1224dig + vectdig, product is pBca9525-sbb1224
----
>dmrb.01.o01	CCATAGCTAGCGGCAGTGGATCTGCTTCTCGTGGTGTTCAGGTTGAAAC
>dmrb.01.o02	GACCGTCACCCGGAGAGATGGTTTCAACCTGAACACCACGAGAA
>dmrb.01.o03	ATCTCTCCGGGTGACGGTCGTACCTTCCCGAAACGTGGTCAGAC
>dmrb.01.o04	CCAGCATACCTGTGTAGTGAACAACGCAGGTCTGACCACGTTTCGGGA
>dmrb.01.o05	GTTCACTACACAGGTATGCTGGAAGACGGTAAAAAAGTTGATTCTTCTCGTG
>dmrb.01.o06	CATGAATTTGAACGGTTTGTTACGGTCACGAGAAGAATCAACTTTTTTACCG
>dmrb.01.o07	ACCGTAACAAACCGTTCAAATTCATGCTGGGTAAACAGGAAGTTATCCG
>dmrb.01.o08	CTGAGCAACACCTTCTTCCCAACCACGGATAACTTCCTGTTTACCCAG
>dmrb.01.o09	TTGGGAAGAAGGTGTTGCTCAGATGTCTGTTGGTCAGCGTGCTAAAC
>dmrb.01.o10	GTAAGCGTAGTCCGGAGAGATGGTCAGTTTAGCACGCTGACCAACAG
>dmrb.01.o11	ATCTCTCCGGACTACGCTTACGGTGCTACAGGTCATCCGGGTATCATC
>dmrb.01.o12	AAAACCAGGGTAGCGTGCGGCGGGATGATACCCGGATGACCTGTA
>dmrb.01.o13	CGCACGCTACCCTGGTTTTCGACGTTGAACTGCTGAAACTGGAATAAGGAT
>dmrb.01.o14	CACTGGGATCCTTATTCCAGTTTCAGCAGTTC
>pca2
CCATAGCTAGCGGCAGTGGATCTGCTTCTCGTGGTGTTCAGGTTGAAACCATCTCTCCGGGTGACGGTCGTACCTTCCCGAAACGTGGTCAGACCTGCGTTGTTCACTACACAGGTATGCTGGAAGACGGTAAAAAAGTTGATTCTTCTCGTGACCGTAACAAACCGTTCAAATTCATGCTGGGTAAACAGGAAGTTATCCGTGGTTGGGAAGAAGGTGTTGCTCAGATGTCTGTTGGTCAGCGTGCTAAACTGACCATCTCTCCGGACTACGCTTACGGTGCTACAGGTCATCCGGGTATCATCCCGCCGCACGCTACCCTGGTTTTCGACGTTGAACTGCTGAAACTGGAATAAGGATCCCAGTG

Partname:     sbb1203
Featurename:  lz_WGLK
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.

Construction File

PCA1 on o1/o2/o3          (pca1)
PCA2 with o1/o2 on pca1   (142 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1203dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1203dig + vectdig, product is pBca9525-sbb1203
----
>o1	
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGT
>o2	
CAGTAGGATCCTTAGCAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>o3	
CAAAAACGAAGAACTGCTGAGTTGGGGCTACCACCTGAAGAACGAAGTTGCTCGTCTGA
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGTTGGGGCTACCACCTGAAGAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTGCTAAGGATCCTACTG