Template:SBB10Project-26253
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your parts into Clotho
You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.
Several references have been provided to give you some background on the biology of your part.
Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.
Finally, you should create a notebook on the main page of the wiki
sbb31: CA42 origin of replication
Source: pEC22-CA42 Target Sequence: agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg Vector: pBjk2741 Short description: oriCA42 Genbank reference: D30056.1 Family: Origin of Replication
This part encodes a DNA cis element
DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.
This part is associated with colE2 orthogonal replicon devices
The colE2 family of replicons encode two elements to enable replication of a circular DNA in E. coli: one is a protein called Rep and the other is a cis element, or more specifically the origin of replication, or just ori. Placing the ori in cis and a complete gene for producing Rep either in cis or in trans should allow replication of the DNA containing ori.
The purpose for these devices is to make additional conditional replicons that can be used in the same cell in E. coli. Ultimately, these will drive replication of the delivered DNAs in our systems allowing them to be cranked up to really high-copy in the cell. Our "Entry Vector" for this project, pBjk274, incidentally, replicates with a colE2-derived replicon. So, take special note of the instructions below as to which plasmid you should use for constructing your basic part.
You should read the following papers
References: PMID 17098894, PMID 8609624, and PMID 2841566.
sbb15: phiC31 attB
Source: Synthetic Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca Vector: pBjk2741 Short descriptions: phiC31 attB Genbank reference: AB306970 (759…842) Family: Phage att site
This part encodes a DNA cis element
DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.
This part is associated with phiC31 integration devices
phiC31 is a bacteriophage integrase. It is somewhat similar in mechanism to Cre recombinase, but it acts on the asymmetric sites attB and attP. It causes these sequences to be recombined to generate attL and attR sequences. This system is useful for integrating large DNAs site-specifically into genomes.
You should read the following papers
References: PMID 14996222, PMID 19002165, PMID 19439387, PMID 12034816
