Template:SBB10Project-20154
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your parts into Clotho
You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.
Several references have been provided to give you some background on the biology of your part.
Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.
Finally, you should create a notebook on the main page of the wiki
sbb19: FokI Cleavage Domain (fok+)
Source: Registry part BBa_K243000 in vector BBa_K157000
Target Sequence: CAGCTGGTTaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaatTgcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaattttTAA
Vector: pBjk2741
Short description: <FokI+!
Flavor: {<part!}
Family: Restriction Endonuclease
Your part exists in the Registry of standard biological parts, but this template sequence differs from what you want by 1 mutation and 3 extra AA at N-term. Take careful note in designing your oligos that you generate the correct product.
This part encodes a DNA modifying enzyme
Different DNA modification enzymes are needed in different flavors, so take special note of what type this one should be. DNA modification enzymes are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.
This part is associated with Zinc Finger Nuclease devices
A zinc finger nuclease is an engineered protein derived from two zinc finger DNA binding proteins and cutting domains usually from a type IIS restriciton enzyme. The special thing about them is that 1) they bind long sequences of DNA, long enough that it might be unique in a eukaryotic genome, and 2) zinc finger proteins that bind to most sequences can be generated somewhat easily. So, you can use a zinc finger nuclease to introduce a ds break at a specific user-defined site in a eukaryotic genome if the protein is delivered to the nucleus of the cell. Eukaryotic ds breaks stimulate homologous recombination. So, if you deliver both the ZFN and a DNA homologous to the target site, you get insertion of your DNA into that site of the genome.
You should read the following papers
References: PMID 18545224, PMID 17603475, PMID 11821858
sbb23: Zinc Finger target
Source: Synthetic Target Sequence: TGTTCGGAGCCGCTTTAACCCACTCTGTGGAAGTGCT Vector: pBca9145 Short description: ZFNS target Family: Restriction Site
This part encodes a DNA cis element
DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.
This part is associated with Zinc Finger Nuclease devices
A zinc finger nuclease is an engineered protein derived from two zinc finger DNA binding proteins and cutting domains usually from a type IIS restriciton enzyme. The special thing about them is that 1) they bind long sequences of DNA, long enough that it might be unique in a eukaryotic genome, and 2) zinc finger proteins that bind to most sequences can be generated somewhat easily. So, you can use a zinc finger nuclease to introduce a ds break at a specific user-defined site in a eukaryotic genome if the protein is delivered to the nucleus of the cell. Eukaryotic ds breaks stimulate homologous recombination. So, if you deliver both the ZFN and a DNA homologous to the target site, you get insertion of your DNA into that site of the genome.
You should read the following papers
References: PMID 18545224, PMID 17603475, PMID 11821858
This part is associated with Zinc Finger Transposase devices
A zinc finger transposase is an engineered protein derived from a zinc finger DNA binding protein and a transposase. A transposase is an enzyme that reacts with DNA at specific sites and then clips that DNA region out of the source DNA forming a "transposome". This DNA/protein complex is highly reactive towards other DNAs. It reacts by inserting the DNA sequence mostly randomly into the target DNA.
Zinc Finger proteins (ZF) are DNA binding proteins. The special thing about them is that 1) the ZF's bind long sequences of DNA, long enough that it might be unique in a eukaryotic genome, and 2) zinc finger proteins that bind to most sequences can be generated somewhat easily. By fusing ZF's to transposase, you can recruit the transposome to a specific site in the genome and thereby bias the insertion site of a transposome into a cell's genome.
You should read the following papers
References: PMID 11821858, PMID 17344320, PMID 19965773
