Talk:20.109(S14):Diagnostic primer design (Day2)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Specificity)
(Specificity)
Line 140: Line 140:
|-
|-
|Silver
|Silver
-
| CACCAGGTTGATTCTGCCTGAC
+
| CAC CAG GTT GAT TCT GCC TGA C
-
| TTCACCATAGACACTACTGGAGC
+
| TTC ACC ATA GAC ACT ACT GGA GC
|  
|  
|  
|  

Revision as of 16:40, 12 February 2014

Contents

T/R Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red CAC CAG GTT GAT ACT GCC TGA C CCT ATC CCG AAC CAA ACC CTG bp 1 bp 260 EH, SSU rRNA
Green
Pink ACC AGG TTG ATT CTG CCT GAC TCT CTC ACG CTC CCT CTC C bp1/bp2 bp252/bp290 EH/VC SSU rRna


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Yellow
Blue GATTCTGCCTGACGTAGATGC CTGCTGGCACCAAACTTGC 10 bp 408 bp E. hellem (AF118143)
Orange


W/F Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink ACC AGG TTG ATT CTG CTG ACG TTGCGAGCATACTATCCCCAG bp 1/2 bp 741/768 VC/EH SSU rRNA
Red ACC AGG TTG ATT CTG CCT GAC ATA TTA CCG CGG CTG CTG bp 1/2 bp 380/421 VC/EH small subunit rRNA
Orange


Specificity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
White
Silver CAC CAG GTT GAT TCT GCC TGA C TTC ACC ATA GAC ACT ACT GGA GC
Yellow CAC CAG GTT GAT TCT GCC TGA C CCA TCC ATT TCC AAC GAC CAT G 1 947 EH
Purple GTCTGGCTGTGTAGATAACTACG
Green


Personal tools