Talk:20.109(S14):Diagnostic primer design (Day2)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Specificity)
(Sensitivity)
Line 95: Line 95:
|  
|  
|  
|  
-
|  
+
|
 +
|-
|
|
|
|
Line 102: Line 103:
|  
|  
|  
|  
 +
|-
|  
|  
|
|
Line 108: Line 110:
|  
|  
|  
|  
 +
|-
|  
|  
|  
|  
|
|
|
|
-
|
 
-
|
 
-
|
 
-
|
 
|  
|  
|
|

Revision as of 14:09, 12 February 2014

Contents

T/R Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red CAC CAG GTT GAT ACT GCC TGA C CCT ATC CCG AAC CAA ACC CTG bp 1 bp 260 EH, SSU rRNA
Green
Pink ACC AGG TTG ATT CTG CCT GAC TCT CTC ACG CTC CCT CTC C bp1/bp2 bp252/bp290 EH/VC SSU rRna


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Yellow
Blue GATTCTGCCTGACGTAGATGC CTGCTGGCACCAAACTTGC 10 bp 408 bp E. hellem (AF118143)
Orange


W/F Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Specificity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Silver
Personal tools