Talk:20.109(S14):Diagnostic primer design (Day2)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(W/F Section)
Line 71: Line 71:
==W/F Section==
==W/F Section==
 +
 +
 +
===Sensitivity===
 +
 +
{| border="1"
 +
|Team color
 +
|Forward (F) primer
 +
|Reverse (R) primer
 +
|Target site (e.g. bp 60), F
 +
|Target site (e.g., bp 300), R
 +
|Is bp # for VC or EH? Which gene?
 +
|-
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|-
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|-
 +
|}
 +
 +
<br style="clear:both;"/>
 +
 +
===Specificity===
 +
 +
{| border="1"
 +
|Team color
 +
|Forward (F) primer
 +
|Reverse (R) primer
 +
|Target site (e.g. bp 60), F
 +
|Target site (e.g., bp 300), R
 +
|Is bp # for VC or EH? Which gene?
 +
|-
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|-
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|-
 +
|}

Revision as of 14:08, 12 February 2014

Contents

T/R Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red CAC CAG GTT GAT ACT GCC TGA C CCT ATC CCG AAC CAA ACC CTG bp 1 bp 260 EH, SSU rRNA
Green
Pink ACC AGG TTG ATT CTG CCT GAC TCT CTC ACG CTC CCT CTC C bp1/bp2 bp252/bp290 EH/VC SSU rRna


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Yellow
Blue GATTCTGCCTGACGTAGATGC CTGCTGGCACCAAACTTGC 10 bp 408 bp E. hellem (AF118143)
Orange


W/F Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Specificity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Personal tools