Talk:20.109(S13):Design mutant (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(W/F)
Current revision (16:09, 20 March 2013) (view source)
(W/F)
 
(9 intermediate revisions not shown.)
Line 60: Line 60:
|-
|-
| Red
| Red
-
|G24Q
+
|G24Q<br>''Note: actually G25Q''
|C GAC AAG GAT GGG GAC CAG ACC ATCACC ACC AAG GAA CTT G
|C GAC AAG GAT GGG GAC CAG ACC ATCACC ACC AAG GAA CTT G
|Thr 28
|Thr 28
Line 67: Line 67:
|-
|-
| Orange
| Orange
-
|E140R, E141R
+
|E140R, E141R<br>''Note: actually E139-140R''
-
|CGATGGCGATGGCCAAGTAAACTATCGACGGTTTGTACAAAATG
+
|CGATGGCGATGGCCAAGTAAACTATCGACGGTTTGTACAAAATG<br>''Note: extra 'A,' ordered CGATGGCGATGGCCAAGTAAACTATCGACGGTTTGTACAAATG''
|Gly 133
|Gly 133
|BtgZI
|BtgZI
Line 81: Line 81:
|-
|-
| Green
| Green
-
|M71D
+
|M71R
|CCT GAA TTC CTT ACT AGG ATG GCT AGA AAA ATG AAG GAC ACA G
|CCT GAA TTC CTT ACT AGG ATG GCT AGA AAA ATG AAG GAC ACA G
|Phe 68
|Phe 68
Line 88: Line 88:
|-
|-
| Blue
| Blue
-
|M72S
+
|M72S<br>''Note: actually M71S''
|CCT GAA TTC CTT ACT AGC ATG GCT AGA AAA ATG AAG GAC AC
|CCT GAA TTC CTT ACT AGC ATG GCT AGA AAA ATG AAG GAC AC
|Phe F
|Phe F
Line 139: Line 139:
|-
|-
| Red
| Red
-
|
+
|G23E
-
|
+
|CTTCTCATTATTCGACAAGGATGAGGACGGTACCATCACCAC
-
|
+
|Gly25
-
|
+
|Kpn1
-
|
+
|E67K
|-
|-
| Orange
| Orange
Line 153: Line 153:
|-
|-
| Yellow
| Yellow
-
|
+
|M59T<br>''Note: actually M51T''
-
|
+
|CA GAA TTG CAG GAT ACG ATC AAT GAA GTC GAC GCT GAT GGC
-
|
+
|Asp63
-
|
+
|AccI
-
|
+
|M124S
|-
|-
| Green
| Green
Line 175: Line 175:
| Pink
| Pink
|G25S
|G25S
-
|CGACAAGGATGGGGACAGCACCATCACCACAAAGGAAC
+
|CGACAAGGATGGGGACAGCACCATCACCACAAAGGAAC<br>''Note: missing silent mutation, ordered CGACAAGGATGGGGACAGCACCATCACCACCAAGGAAC''
|Thr29
|Thr29
|Sty1
|Sty1
Line 181: Line 181:
|-
|-
| Purple
| Purple
-
|
+
|A128E
-
|
+
|GAA ATG ATA AGG GAA GAA GAT ATC GAT GGC GAT GGC C
-
|
+
|Gly 132
-
|
+
|BtgZI
-
|
+
|M124S
|-
|-
| Platinum
| Platinum
-
|R125P
+
|R125P<br>''Note: actually R126P''
|GTTGATGAAATGATACCGGAAGCAGATATCGATGGCGATGGCC
|GTTGATGAAATGATACCGGAAGCAGATATCGATGGCGATGGCC
|Gly 131
|Gly 131

Current revision

Reference mutant choicesl

The mutants below were chosen based on promising student results in previous years, then tested by the teaching faculty.

Mutation X#Z Primer (forward) Silent mutation New restriction site Known effect
D24H C GAC AAG GAT GGG CAC GGT ACC ATC ACC -ANS Gly25 KpnI Affinity decrease and cooperativity increase
E67K GGC AAT GGT ACG ATT TAC TTT CCT AAA TTT CTT ACT ATG ATG GC Gly63 RsaI Small affinity increase, and perhaps slight cooperativity decrease
T79P GA AAA ATG AAG GAC CCA GAC AGC GAA GAG GAA ATC C Thr79 PpuMI Small affinity decrease and perhaps slight cooperativity increase
M124S GAT GAA GAA GTT GAT GAA AGT ATA CGG GAA GCA GAT ATC GAT GG Arg126 AccI Affinity decrease and cooperativity increase


Note that we also investigated D22H and D129P, but both of these turned out to destroy calcium response, and in low salt conditions to eliminate fluorescence itself. The limited choices above aren't meant to imply that you must narrowly investigate these residues or ones just like them.

T/R

Please list all amino acid residues with respect to calmodulin itself rather than the chimeric protein inverse pericam.

Team colour Mutation X#Z Primer (forward) Silent mutation New restriction site Reference mutant choice
Teaching example S101L GG AAC GGC TAC ATC CTC GCT GCG CAG TTA CGT CAC G Ala 103 FspI N/A
Red G24Q
Note: actually G25Q
C GAC AAG GAT GGG GAC CAG ACC ATCACC ACC AAG GAA CTT G Thr 28 Sty1 D24H
Orange E140R, E141R
Note: actually E139-140R
CGATGGCGATGGCCAAGTAAACTATCGACGGTTTGTACAAAATG
Note: extra 'A,' ordered CGATGGCGATGGCCAAGTAAACTATCGACGGTTTGTACAAATG
Gly 133 BtgZI E67K
Yellow K77E CTATGATGGCTAGAAAAATGGAGGACACAGACTCC Ser81 BsaXI T79P
Green M71R CCT GAA TTC CTT ACT AGG ATG GCT AGA AAA ATG AAG GAC ACA G Phe 68 EcoRI T79P
Blue M72S
Note: actually M71S
CCT GAA TTC CTT ACT AGC ATG GCT AGA AAA ATG AAG GAC AC Phe F EcoRI M124S
Pink
Purple M144R GAG GAG TTT GTA CAA AGG ATG ACA GCA AAG TAA GAA TTC GAA GC Glu139 BseRI M124S
Platinum D80R CT AGA AAA ATG AAG GAC ACA CGT AGC GAA GAG GAA ATC CGA GAA GC Asp80 AflIII M124S


W/F

Please list all amino acid residues with respect to calmodulin itself rather than the chimeric protein inverse pericam.

Team colour Mutation X#Z Primer (forward) Silent mutation New restriction site Reference mutant choice
Teaching example S101L GG AAC GGC TAC ATC CTC GCT GCG CAG TTA CGT CAC G Ala 103 FspI N/A
Red G23E CTTCTCATTATTCGACAAGGATGAGGACGGTACCATCACCAC Gly25 Kpn1 E67K
Orange F16S GCA GAG TTC AAA GAA GCC TCC TCA TTA TTC GAC AAG GAT GG None BseR1 M124S
Yellow M59T
Note: actually M51T
CA GAA TTG CAG GAT ACG ATC AAT GAA GTC GAC GCT GAT GGC Asp63 AccI M124S
Green M76G CTATGATGGCTAGAAAAGGGAAGGACACAGACAGCGAGGAGG Glu 81 BseRI T79P
Blue D22E TTC TCA TTA TTC GAC AAG GAA GGG GAC GGT ACC ATC ACC Gly 25 Kpn1 D24H
Pink G25S CGACAAGGATGGGGACAGCACCATCACCACAAAGGAAC
Note: missing silent mutation, ordered CGACAAGGATGGGGACAGCACCATCACCACCAAGGAAC
Thr29 Sty1 D24H
Purple A128E GAA ATG ATA AGG GAA GAA GAT ATC GAT GGC GAT GGC C Gly 132 BtgZI M124S
Platinum R125P
Note: actually R126P
GTTGATGAAATGATACCGGAAGCAGATATCGATGGCGATGGCC Gly 131 BtgZI E67K


Personal tools