Talk:20.109(S13):Design mutant (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(T/R)
(T/R)
Line 89: Line 89:
| Blue
| Blue
|M72S
|M72S
-
|CCTGAATTCCTTACTAGCATGGCTAGAGCTAGAAAAATGAAGGACAC
+
|CCT GAA TTC CTT ACT AGC ATG GCT AGA GCT AGA AAA ATG AAG GAC AC
|Phe F
|Phe F
|EcoRI
|EcoRI

Revision as of 16:46, 12 March 2013

Reference mutant choicesl

The mutants below were chosen based on promising student results in previous years, then tested by the teaching faculty.

Mutation X#Z Primer (forward) Silent mutation New restriction site Known effect
D24H C GAC AAG GAT GGG CAC GGT ACC ATC ACC -ANS Gly25 KpnI Affinity decrease and cooperativity increase
E67K GGC AAT GGT ACG ATT TAC TTT CCT AAA TTT CTT ACT ATG ATG GC Gly63 RsaI Small affinity increase, and perhaps slight cooperativity decrease
T79P GA AAA ATG AAG GAC CCA GAC AGC GAA GAG GAA ATC C Thr79 PpuMI Small affinity decrease and perhaps slight cooperativity increase
M124S GAT GAA GAA GTT GAT GAA AGT ATA CGG GAA GCA GAT ATC GAT GG Arg126 AccI Affinity decrease and cooperativity increase


Note that we also investigated D22H and D129P, but both of these turned out to destroy calcium response, and in low salt conditions to eliminate fluorescence itself. The limited choices above aren't meant to imply that you must narrowly investigate these residues or ones just like them.

T/R

Please list all amino acid residues with respect to calmodulin itself rather than the chimeric protein inverse pericam.

Team colour Mutation X#Z Primer (forward) Silent mutation New restriction site Reference mutant choice
Teaching example S101L GG AAC GGC TAC ATC CTC GCT GCG CAG TTA CGT CAC G Ala 103 FspI N/A
Red G24Q C GAC AAG GAT GGG GAC CAG ACC ATCACC ACC AAG GAA CTT G Thr 28 Sty1 D24H
Orange
Yellow
Green M71D T79P
Blue M72S CCT GAA TTC CTT ACT AGC ATG GCT AGA GCT AGA AAA ATG AAG GAC AC Phe F EcoRI M124S
Pink
Purple
Platinum D80R CT AGA AAA ATG AAG GAC ACA CGT AGC GAA GAG GAA ATC CGA GAA GC D80 AflIII M124S


W/F

Please list all amino acid residues with respect to calmodulin itself rather than the chimeric protein inverse pericam.

Team colour Mutation X#Z Primer (forward) Silent mutation New restriction site Reference mutant choice
Teaching example S101L GG AAC GGC TAC ATC CTC GCT GCG CAG TTA CGT CAC G Ala 103 FspI N/A
Red
Orange
Yellow
Green
Blue
Pink
Purple
Platinum


Personal tools