Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare

Revision as of 14:47, 12 February 2013 by Sarah N. Yu (Talk | contribs)
Jump to: navigation, search

Contents

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CAT GCT TGC CAA CAC AG GAA TGG TCT GGT TGC TTC bp 9 bp 234 E. Hellem: polar tube protein gene
Green
Pink agggtgg aaatggggat ggaag CAT TCT GTC CTG GCT GGC AT bp 24 bp 268 E. Hellem: polar tube protein gene
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC small subunit ribosomal RNA gene


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple 5' GCG ATG ATT TAG TCT GGC 3' 5’ GA TTT CTC CCT GCC CAC TGT 3’ bp 93, F bp 699, R VC, SSU rRNA
Red GGT TGA TTC TGC CTG ACG TGG CCT TCG TCC TTC ATC ACC ACA A bp 6, F bp 588, R VC, SSU RNA
Orange 5'cgt agt cat aga agg gca aag ag3' 5' ctc tct ctc tac ctg cta ttg ta 3' 441 1005 V. corneae TV4/TV5 SSU rRNA
Blue CCGCAATCAGGGACGAA GTCAACGTCACTGTCTTGG 60 195 V. corneae TV4/TV5 SSU rRNA


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple
Yellow
Red
Platinum


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink TTCTGCCTGACGTAGATG TCAACCGTCACTGTCTTG bp 12 bp 213 for VC TV4 SSU rRNA
Green AATCAGGGACGAATAGCTC TGATAGTCCTGCGTCTTATTC bp 64 bp 169 VC SSU rRNA, full sequence
Orange CTGCCTGACGTAGATGCTAG CTGTCTTGGTAGTCCACTAC bp 14 bp 203 VC TV4 SSU rRNA gene
Blue TBA TBA TBA TBA TBA


Personal tools