Talk:20.109(S13):Context-setting and primer design (Day1)
From OpenWetWare
Contents |
T/R section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
| Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Grey (Platinum) :) | CCA TGC TTG CCA ACA CAG G | GGT CTG GTT GCT TCC ACT TCC | bp 8 | bp 227 | E. Hellem: polar tube protein gene |
| Green | |||||
| Pink | |||||
| Yellow | CTGACGTGGATGCTATTC | CCGTCAACCGTCACTGTC | bp 18 | bp 199 | VC small subunit ribosomal RNA gene |
Specificity
| Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Purple | |||||
| Red | |||||
| Orange | |||||
| Blue | CCGCAATCAGGGACGAA | GTCAACGTCACTGTCTTGG | 60 | 195 | V. corneae TV4/TV5 SSU rRNA |
W/F section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
| Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Specificity
| Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? | Pink | gctagtctctaagattaagcc | tcccgtcaaccgtcactgtc | bp 29 | bp199 | for VC TV4 SSU rRNA |
| Green | |||||||||||
| Orange | CTGCCTGACGTAGATGCTAG | CTGTCTTGGTAGTCCACTAC | bp 14 | bp 203 | VC TV4 SSU rRNA gene | ||||||
| Blue | TBA | TBA | TBA | TBA | TBA
- |


