Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Sensitivity)
Line 18: Line 18:
|-
|-
| Grey (Platinum) :)  
| Grey (Platinum) :)  
-
|
+
| ccagccaggacagaatggag
-
|
+
| GGA GAT AAC ACC TGG AAT GGT CTG
|
|
|
|

Revision as of 17:09, 7 February 2013

Contents

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) ccagccaggacagaatggag GGA GAT AAC ACC TGG AAT GGT CTG
Green
Pink
Yellow


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple
Red
Orange
Blue


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Personal tools