Talk:20.109(S13):Context-setting and primer design (Day1)
From OpenWetWare
(→Update for everyone) |
(→Update for everyone) |
||
| Line 5: | Line 5: | ||
Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked [[Media:Vcorneae_SSU-Broad-direct.gb | here]]. For comparison, the complete sequences from [[Media:Vcorneae_SUU-complete-Baker.gb | Baker et al]] and [[<edia:Vcorneae_SUU-complete-DaSilva.gb DaSilva et al.] are each linked. You can ''Align Sequences'' (under ''Tools'') in ApE to see the differences for yourself.<font color=red>In progress for WF.</font color> | Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked [[Media:Vcorneae_SSU-Broad-direct.gb | here]]. For comparison, the complete sequences from [[Media:Vcorneae_SUU-complete-Baker.gb | Baker et al]] and [[<edia:Vcorneae_SUU-complete-DaSilva.gb DaSilva et al.] are each linked. You can ''Align Sequences'' (under ''Tools'') in ApE to see the differences for yourself.<font color=red>In progress for WF.</font color> | ||
| - | As a default, we will order these primers on Tuesday | + | As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C. |
| - | However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm | + | However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm. |
==T/R section== | ==T/R section== | ||
Revision as of 15:49, 15 February 2013
Contents |
Update for everyone
As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for V corneae. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).
Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked here. For comparison, the complete sequences from Baker et al and [[<edia:Vcorneae_SUU-complete-DaSilva.gb DaSilva et al.] are each linked. You can Align Sequences (under Tools) in ApE to see the differences for yourself.In progress for WF.
As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C.
However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm.
T/R section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
| Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Grey (Platinum) :) | CAT GCT TGC CAA CAC AG Agi: PT so unchanged | GAA TGG TCT GGT TGC TTC Agi: PT so unchanged | bp 9 | bp 251 | E. Hellem: polar tube protein gene |
| Green | AGG TTG ATT CTG CCT GAC Agi: fine | CGG AAC CAA ACC CTG AT Agi: CGG TAC AAA ACC CTA AT | bp 5 | bp 236 | VC: SSU rRNA |
| Pink | ttctgcctgacgtagatg Agi: fine | cctctccggaaccaaac Agi: CCT CTC CGG TAC AAA AC | bp 12 | bp 226 | VC |
| Yellow | CTGACGTGGATGCTATTC Agi: ctg acg tag atg cta gtc | CCGTCAACCGTCACTGTC Agi: fine | bp 18 | bp 199 | VC small subunit ribosomal RNA gene |
Specificity
| Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Purple | 5' GCG ATG ATT TAG TCT GGC 3' Agi: fine | 5’ CAA TTT CCA ACG ACC ATG C 3’ Agi: fine | bp 93, F | bp 879, R | VC, SSU rRNA |
| Red | GGT TGA TTC TGC CTG ACG TGG Agi:fine | CCT TCG TCC TTC ATC ACC ACA A Agi: CCT TCG TCC TTG ATC ACC GAA T (yours doesn't match any known sequence in last 4 bp -- do I have right region?) | bp 6, F | bp 588, R | VC, SSU RNA |
| Orange | 5'cgt agt cat aga agg gca aag ag3' Agi: fine | 5' ctc tct ctc tac ctg cta ttg ta 3' Agi: fine | 441 | 1005 | V. corneae TV4/TV5 SSU rRNA |
| Blue | CCGCAATCAGGGACGAA Agi: fine | GTCAACGTCACTGTCTTGG<bra>Agi: GTC AAC C GTC ACT GTC TTG G (insertion) | 60 | 195 | V. corneae TV4/TV5 SSU rRNA |
W/F section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
| Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Purple | 5' GGACGGCTCAGTGATAG 3' | 5' CTACCACACCCAGAACTTAC 3' | bp 84, F | bp 167, R | EH, SSU rRNA |
| Yellow | 5' GAGAAGTAAGATGTTTAGCAAGTAT 3' | 5' CATCACCACAAAAGTCCAA 3' | bp 359, F | bp 630, R | EH, SSU rRNA |
| Red | 5' CCA GGT TGA TTC TGC CTG 3' | 5' CTC TCC GGA ACC AAA CC 3' | bp 9, F | bp 225, R | VC, SSU, rRNA |
| Platinum | 5' CAT GTT GAT TCT GCC TGA C 3' | 5' CTC TCC TGA ACC AAA CCC TG 3' | bp 4, F | bp 278, R | EH, SSU rRNA |
Specificity
| Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
| Pink | TTCTGCCTGACGTAGATG | TCAACCGTCACTGTCTTG | bp 12 | bp 213 | for VC TV4 SSU rRNA |
| Green | AATCAGGGACGAATAGCTC | TGATAGTCCTGCGTCTTATTC | bp 64 | bp 169 | VC SSU rRNA, full sequence |
| Orange | CTGCCTGACGTAGATGCTAG | CTGTCTTGGTAGTCCACTAC | bp 14 | bp 203 | VC TV4 SSU rRNA gene |
| Blue | ACGAGCAATACAGGAGTGG | TCCATCTGAGCACCTTCC | bp 841 | bp 1049 | VC SSU rRNA |


