Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare

Revision as of 23:07, 11 February 2013 by Sung Won Cho (Talk | contribs)
Jump to: navigation, search

Contents

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CCA TGC TTG CCA ACA CAG G GGT CTG GTT GCT TCC ACT TCC bp 8 bp 227 E. Hellem: polar tube protein gene
Green
Pink
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC small subunit ribosomal RNA gene


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple 5' AGC CGC GGT AAT ACC GAC 3' 5’ GA TTT CTC CCT GCC CAC TGT 3’ bp 385, F bp 699, R VC, SSU rRNA
Red
Orange
Blue CCGCAATCAGGGACGAA GTCAACGTCACTGTCTTGG 60 195 V. corneae TV4/TV5 SSU rRNA


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple
Yellow
Red
Platinum


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink TTCTGCCTGACGTAGATG TCAACCGTCACTGTCTTG bp 12 bp 213 for VC TV4 SSU rRNA
Green AATCAGGGACGAATAGCTC TGATAGTCCTGCGTCTTATTC bp 64 bp 169 VC SSU rRNA, full sequence
Orange CTGCCTGACGTAGATGCTAG CTGTCTTGGTAGTCCACTAC bp 14 bp 203 VC TV4 SSU rRNA gene
Blue TBA TBA TBA TBA TBA


Personal tools