Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Specificity)
(Specificity)
Line 179: Line 179:
|VC TV4 SSU rRNA gene
|VC TV4 SSU rRNA gene
|-
|-
 +
-
 +
| Blue
 +
| TBA
 +
| TBA
 +
| TBA
 +
| TBA
 +
| TBA
 +
-
|}
|}
<br style="clear:both;"/>
<br style="clear:both;"/>

Revision as of 14:57, 11 February 2013

Contents

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CCA TGC TTG CCA ACA CAG G GGT CTG GTT GCT TCC ACT TCC bp 8 bp 227 E. Hellem: polar tube protein gene
Green
Pink
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC small subunit ribosomal RNA gene


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple
Red
Orange
Blue CCGCAATCAGGGACGAA GTCAACGTCACTGTCTTGG 60 195 V. corneae TV4/TV5 SSU rRNA


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Specificity

-
Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Blue TBA TBA TBA TBA TBA
Pink gctagtctctaagattaagcc tcccgtcaaccgtcactgtc bp 29 bp199 for VC TV4 SSU rRNA
Green
Orange CTGCCTGACGTAGATGCTAG CTGTCTTGGTAGTCCACTAC bp 14 bp 203 VC TV4 SSU rRNA gene
Blue TBA TBA TBA TBA TBA

-


Personal tools