Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Sensitivity)
Line 40: Line 40:
|Yellow
|Yellow
|CTGACGTGGATGCTATTC
|CTGACGTGGATGCTATTC
-
|GACAGTGACGGTTGACGG
+
|CCGTCAACCGTCACTGTC
|bp 18
|bp 18
|bp 199
|bp 199

Revision as of 10:16, 11 February 2013

Contents

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) ccagccaggacagaatggag GGA GAT AAC ACC TGG AAT GGT CTG
Green
Pink
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC TV4 small subunit ribosomal RNA gene


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple
Red
Orange
Blue CCGCAATCAGGGACGAA GTCAACGTCACTGTCTTGG 60 195 V. corneae TV4/TV5 SSU rRNA


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Blue TBA TBA TBA TBA TBA


Personal tools