Talk:20.109(S11):Complete DNA design (Day2)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(T/R)
(T/R)
Line 26: Line 26:
|We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference.
|We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference.
|-
|-
-
|
+
|Yellow
-
|
+
|5' CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTTGCTATTTTTACCTCTGGCGGTGATATTGGATCC 3'
-
|
+
5’GGATCCAATATCACCGCCAGAGGTAAAAATAGCAAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3’
 +
|We decided to change 2 nucleotides in the -35 region of P(R), and 1 nucleotide in the -10 region. We also added an extra basepair to between these two regions, increasing its length. These changes make the promoter less ideal of a binding site, therefore making it a weaker promoter. We chose the changes in nucleotides based on the lac promoter consensus sequence.
|-
|-
|
|

Revision as of 15:46, 10 March 2011

High-level designs and implementation with primers

T/R

Group Forward primer; <br>Reverse primer Summary of approach
Blue 5’CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGTTTTACCTCTGGCGGTGATAGGG3’

5’GATCCCCTATCACCGCCAGAGGTAAAACAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3’

The Plux-lamda promoter may be leaky due to the high basal expression of the Pr promoter. We are deleting part of the -35 region (after Or2) in the Pr promoter and adding 2 G's in the middle of -10 region (right after Or1) in order to reduce the strength of the promoter and decrease the AT richness in the sequence.
Pink 5'CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATACCTCTGGCGGTGATATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAGGATCC3'

5'AAATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATATCACCGCCAGAGGTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3'

We are inserting a second copy of the Or1 sequence directly infront of Or2 to hopefully improve repressing of the operons
Green 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCCCCTAACACCGTGCGTGTTGCCCCTTTTACCTCTGGCGGTGATACCGGATCC3’
3'GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGGGGATTGTGGCACGCACAACGGGGAAAATGGAGACCGCCACTATGGCCTAGG5'
We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference.
Yellow 5' CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTTGCTATTTTTACCTCTGGCGGTGATATTGGATCC 3'

5’GGATCCAATATCACCGCCAGAGGTAAAAATAGCAAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3’

We decided to change 2 nucleotides in the -35 region of P(R), and 1 nucleotide in the -10 region. We also added an extra basepair to between these two regions, increasing its length. These changes make the promoter less ideal of a binding site, therefore making it a weaker promoter. We chose the changes in nucleotides based on the lac promoter consensus sequence.


W/F

Group Forward primer; <br>Reverse primer Summary of approach


Personal tools