Talk:20.109(S13):Context-setting and primer design (Day1): Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 152: | Line 152: | ||
|- | |- | ||
| Blue | | Blue | ||
| | | TBA | ||
| | | TBA | ||
| | | TBA | ||
| | | TBA | ||
| | | TBA | ||
|- | |- | ||
| | | |
Revision as of 17:03, 8 February 2013
T/R section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Grey (Platinum) :) | ccagccaggacagaatggag | GGA GAT AAC ACC TGG AAT GGT CTG | |||
Green | |||||
Pink | |||||
Yellow |
Specificity
Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Purple | |||||
Red | |||||
Orange | |||||
Blue | CCGCAATCAGGGACGAA | GTCAACGTCACTGTCTTGG | 60 | 195 | V. corneae TV4/TV5 SSU rRNA |
W/F section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Specificity
Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Blue | TBA | TBA | TBA | TBA | TBA |